Em formação

Maneira programática de diferenciar homodímeros de heterodímeros?

Maneira programática de diferenciar homodímeros de heterodímeros?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

ParaPDBarquivos existe uma maneira programática simples de determinar se o arquivo é composto de homodímeros ou heterodímeros.

Eu tenho muitos arquivos, então uma ferramenta online ou algum psuedocode / scripts ajudaria mais do que avaliar cada um manualmente.


Eu apenas compararia as sequências de aminoácidos das cadeias de proteínas individuais. Com alguma margem de manobra para resíduos não observados na densidade, ou seja, requer apenas 90 ou 95% de identidade de sequência, ou ignora lacunas.

Isso não vai lhe dizer nada sobre se o dímero (se você observar várias moléculas na unidade assimétrica) é realmente real. Para isso, você precisa fazer um experimento, uma pesquisa bibliográfica ou ver se um software como o servidor PISA pode lhe dar uma pista.


Caso você queira escrever sua própria sub-rotina,
1. Analise o todo.pdbarquivo para o número de cadeias presentes, se várias, prossiga.
2. Crieindex_counterpara cada aminoácido de uma única cadeia.
3. Agora, para uma única corrente. Enquanto você verifica cada aminoácido, execute umi = i + 1operação para aquele específicocontador de aminoácidos.
4. Compare ocontador de aminoácidosentre / entre as cadeias.
5. Correspondência exata = homômero ou correspondência não exata = heterômero.
Espero que você entenda a lógica.


Ann K. Corsi, Ph.D.

Nossa pesquisa visa compreender a questão básica da biologia do desenvolvimento: "Durante o desenvolvimento, como o destino de uma célula é especificado?" Ou, mais simplesmente, como uma célula sabe que se torna uma célula muscular e não uma célula nervosa ou algum outro tipo de célula? Proteínas específicas contribuem para o destino de uma célula, e reguladores chamados fatores de transcrição controlam a presença dessas proteínas. Um exame cuidadoso de como os fatores de transcrição desempenham sua função, portanto, será fundamental para a compreensão da especificação do destino da célula. Estamos estudando a especificação do destino da célula no contexto da regulação da transcrição no mesoderma. O mesoderma é a camada germinativa embrionária intermediária da qual os tecidos muscular, conectivo e cardíaco são derivados. O organismo modelo que usamos é o nematóide não parasita do solo, Caenorhabditis elegans. C. elegans tem uma série de vantagens para estudar o desenvolvimento, como células transparentes, informações completas do genoma e genética poderosa. Os animais também têm um tempo de geração curto de 3 dias permitindo uma experimentação rápida. Além disso, os nematóides têm vários tipos de tecido de origem mesodérmica e, ainda assim, um pequeno número total de células mesodérmicas, de modo que podemos nos concentrar em eventos no nível de uma única célula.

Vários fatores de transcrição desempenham um papel na especificação do destino da célula. Estamos nos concentrando em um fator de transcrição CeTwist básico hélice-alça-hélice (bHLH), que desempenha um papel na padronização e especificação do mesoderma em C. elegans. Nosso objetivo é compreender o mecanismo pelo qual esse fator controla a expressão de genes-alvo em um conjunto diversificado de células mesodérmicas. CeTwist forma heterodímeros com outro fator bHLH, CeE / DA. Como primeiro passo em direção ao nosso objetivo, identificamos genes-alvo dos heterodímeros usando microarrays que representam todos os transcritos no genoma de C. elegans (Wang et al., 2006). Também exploramos o mecanismo de regulação de um dos genes-alvo, arg-1 (Zhao et al., 2007). Na região do promotor de arg-1, encontramos três elementos que são exclusivamente necessários para o padrão de expressão de arg-1. Atualmente, estamos buscando várias linhas de investigação para entender como esses elementos são usados ​​exclusivamente pelos fatores bHLH para regular a transcrição em células individuais. Além disso, identificamos um papel para CeTwist contendo homodímeros (manuscrito em preparação) e estamos usando uma abordagem de microarray para identificar genes-alvo dos homodímeros. Finalmente, a fim de compreender a regulação temporal e espacial dos genes CeTwist e CeE / DA, estamos usando uma abordagem de gene repórter para identificar elementos importantes para sua expressão. Coletivamente, esperamos que nossas abordagens multifacetadas forneçam uma compreensão mecanicista do controle do gene alvo por fatores bHLH no desenvolvimento do mesoderma.

Nosso trabalho tem consequências importantes para a saúde humana. Mutações no gene Twist humano estão associadas a um distúrbio de desenvolvimento denominado síndrome de Saethre-Chotzen, no qual os pacientes apresentam defeitos craniofaciais e nos dedos. Mutações em homólogos humanos de vários genes alvo CeTwist, incluindo arg-1, estão associadas a outras síndromes humanas causando defeitos semelhantes aos observados em pacientes com Saethre-Chotzen, e existem doenças semelhantes cuja base genética subjacente ainda não é conhecida. Assim, os genes de C. elegans identificados pelas abordagens genéticas e moleculares em nosso laboratório revelarão candidatos a genes humanos defeituosos em indivíduos que sofrem de síndromes de desenvolvimento relacionadas. Já encontramos vários genes candidatos e esperamos que um entendimento cuidadoso de sua regulação nos ajude a entender mais sobre as doenças craniofaciais em humanos.

Financiamento de Pesquisa

O trabalho do Dr. Corsi é financiado por uma bolsa R15 Academic Research Enhancement Award (AREA) do Instituto Nacional de Pesquisa Dentária e Craniofacial do National Institutes of Health. & # 160

Publicações Recentes

1. Kim, S, Twigg, SRF, Scanlon, VA, Chandra, A, Hansen, TJ, Alsubait A, Fenwick AL, McGowan SJ, Lord H, Lester T, Sweeney E, Weber A, Cox H, Wilkie AOM, Golden , A, Corsi, AK (2017) Mutações localizadas no domínio básico TWIST1 e TWIST2 causam quatro doenças humanas distintas que podem ser modeladas em C. elegans. Hum Mol Genet. 26:2118-2132.

2. Corsi, AK, Wightman B, e Chalfie M (2015) A Transparent Window into Biology: A Primer on Caenorhabditis elegans. Genética 200:387-407.


Resumo

As meganucleases cortam sequências únicas longas (& # x0003e12 bp) nos genomas e podem ser usadas para induzir a engenharia do genoma direcionado por recombinação homóloga na vizinhança de seu local de clivagem. No entanto, o uso de meganucleases naturais é limitado pelo repertório de suas sequências alvo, e esforços consideráveis ​​foram feitos para projetar meganucleases reprojetadas que clivam os alvos escolhidos. Meganucleases homodiméricas como I-CreI forneceram uma estrutura, mas só podem ser modificadas para reconhecer novas sequências de DNA quase palindrômicas, limitando sua aplicabilidade geral. Outros grupos usaram o redesenho da interface de dímero e a ligação de peptídeo para controlar a heterodimerização entre meganucleases relacionadas, como I-DmoI e I-CreI, mas até agora não houve nenhuma aplicação deste voltado especificamente para os andaimes de bibliotecas combinatórias existentes de I-CreI . Aqui, mostramos que a engenharia de meganucleases para formar heterodímeros obrigatórios resulta em endonucleases funcionais que cortam sequências não palindrômicas. O algoritmo de projeto de proteína (FoldX v2.7) foi usado para projetar interfaces de heterodímero específicas entre dois monômeros de meganuclease, que foram projetados para reconhecer diferentes sequências de DNA. Os novos monômeros favorecem a formação de heterodímero funcional e evitam o reconhecimento do local do homodímero. Este projeto aumenta enormemente o repertório potencial de sequências de DNA que podem ser especificamente direcionadas por meganucleases I-CreI projetadas e abre o caminho para uma engenharia de genoma direcionada mais segura.


Resultados

A interação PRLR-PRLR específica é detectada pelo ensaio de complementação de luciferase dividida

Paralelamente aos nossos estudos de complementação GHR-GHR, procuramos empregar o ensaio de complementação de luciferase dividida (45) para estudar a associação PRLR-PRLR. Primeiro criamos as proteínas quiméricas hPRLR-Nluc e PRLR-Cluc com um ligante flexível de 10 resíduos (AAAGSGGGGS) entre o receptor e os fragmentos luc (Figura 1 A). Para comparação, nossos previamente descritos GHR-Nluc, GHR-Cluc, EPOR-Cluc e fragmento ER-Cluc (44) também são mostrados na Figura 1 A. Como anteriormente, empregamos a linha de células de fibrossarcoma humano que expressa JAK2, & # x003b32A-JAK2 (53, & # x0201355), como um hospedeiro para a expressão das quimeras. Um vetor de expressão que codifica PRLR de tipo selvagem foi usado como um controle positivo e apenas um vetor como um controle negativo para experiências comparando a transfecção transitória de vetores que codificam PRLR-Nluc e PRLR-Cluc. A imunotransferência de extratos de detergente de células transfectadas com anti-PRLR (Figura 1 B) revelou que ambas as quimeras foram expressas e detectadas, como esperado, no M apropriador. Além disso, tanto GH quanto PRL causaram ativação aguda de sinalização, conforme detectado por immunoblotting com anti-pSTAT3 / anti-STAT3 (Figura 1 C), indicando dobramento apropriado e apresentação de superfície celular de receptores quiméricos PRLR-luc, como mostrado anteriormente para GHR -luc e quimeras EPOR-luc (44).

Complementação específica de luciferase de PRLR-Nluc com PRLR-Cluc. A, Diagrama esquemático de quimeras de fragmentos de luciferase usadas neste estudo. Todas as construções descritas no texto e em Materiais e Métodos. PRLR-Nluc e PRLR-Cluc: hPRLR de comprimento total fundido no final do ICD a Nluc ou Cluc, respectivamente, por meio de um peptídeo ligante. GHR-Nluc e GHR-Cluc: GHR humano completo fundido no final do ICD a Nluc ou Cluc por meio de um peptídeo ligante. EPOR-Cluc: EPOR humano completo fundido no final do ICD a Cluc por meio de um peptídeo ligante. ER-Cluc: fragmento ER humano fundido com Cluc. B, PRLR-Nluc e PRLR-Cluc são especificamente imunodetectáveis ​​e exibem a migração SDS-PAGE esperada. As células & # x003b32A-JAK2 foram transfectadas transitoriamente para expressar PRLR, PRLR-Nluc, PRLR-Cluc ou com o vetor vazio pcDNA3.1 (+) / zeo. Extratos de células detergentes foram resolvidos por SDS-PAGE e imunotransferidos com anti-PRLR (H-300). As quimeras PRLR e PRLR-luc são indicadas por um asterisco e exibem a migração esperada. NS, não específico. C, PRLR-Nluc e PRLR-Cluc permitem a sinalização induzida por ligante aguda normal. As células & # x003b32A-JAK2 foram transfectadas para expressar PRLR, PRLR-Nluc, PRLR-Cluc ou com o vetor vazio pcDNA3.1 (+) / zeo. Tratamento: & # x000b1GH ou PRL. Imunoblot de extratos celulares para STAT3 fosforilado e total. D, Complementação específica de luciferase de PRLR-Nluc com PRLR-Cluc. As células & # x003b32A-JAK2 foram transitoriamente transfectadas com plasmídeos de expressão que codificam as quimeras indicadas. A bioluminescência foi determinada em triplicado (a inserção mostra os sinais codificados por cores reais) e é exibida graficamente como média & # x000b1 SE do fluxo total (fótons / s & # x000d7 1000). Para PRLR-Nluc / PRLR-Cluc vs PRLR-Nluc / EPOR-Cluc ou PRLR-Nluc / ER-Cluc, P & # x0003c .05, respectivamente. Consulte Materiais e métodos para obter detalhes.

Para avaliar a interação de receptores, nós coexpressamos transitoriamente PRLR-Nluc com PRLR-Cluc em & # x003b32A-JAK2 e medimos a reconstituição da atividade de luciferase (complementação de Nluc com Cluc) usando imagens de bioluminescência IVIS 100 de células transfectadas vivas na presença de D- luciferina (Figura 1 D). Complementação substancial resultou com coexpressão PRLR-Nluc / PRLR-Cluc, enquanto muito pouco sinal foi detectado com coexpressão PRLR-Nluc / EPOR-Cluc ou PRLR-Nluc / ER-Cluc. Este resultado sugere pré-associação específica independente de ligante de PRLRs, consistente com estudos usando métodos diferentes que demonstraram a formação de dímero de PRLR independente de ligante (25, 31).

Efeitos do tratamento com ligante na complementação de PRLR-PRLR

Para investigar os efeitos do ligante na complementação de PRLR-PRLR, isolamos células & # x003b32A-JAK2-PRLR-Nluc / PRLR-Cluc, nas quais PRLR-Nluc e PRLR-Cluc são coexpressos de forma estável no fundo da célula & # x003b32A-JAK2. Como nas transfecções transitórias na Figura 1, PRLR-Nluc e PRLR-Cluc foram detectados em células & # x003b32A-JAK2-PRLR-Nluc / PRLR-Cluc por imunoprecipitação anti-PRLR e immunoblotting, e ambas as quimeras foram detectadas por anti-pY immunoblotting após breve tratamento das células com PRL (Figura 2 A, painel superior). Neste clone estável, PRLR-Nluc tinha abundância ligeiramente maior e era correspondentemente mais fosforilado por indução em resposta a PRL do que PRLR-Cluc. Como esperado, a PRL também causou fosforilação aguda de JAK2 e STAT5, conforme detectado por imunotransferência de extratos celulares (Figura 2 A, painel inferior).

PRL e GH induzem especificamente mudanças temporais na complementação de PRLR-PRLR. A, sinalização de PRL em células & # x003b32A-JAK2-PRLR-Nluc / PRLR-Cluc, nas quais PRLR-Nluc e PRLR-Cluc são expressos de forma estável no fundo & # x003b32A-JAK2. Tratamento: & # x000b1PRL. Painel superior, extratos de células de detergente foram imuno-precipitados com anti-PRLR (anti-PRLRcyt-AL84), resolvido por SDS-PAGE e sequencialmente immunoblotted com anti-pY e anti-PRLR (anti-PRLRcyt-AL84) Painel inferior, Immunoblot de extratos celulares para anti-pJAK2, anti-JAK2, anti-pSTAT5 e anti-STAT5. As pontas da seta preta indicam PRLR-Nluc fosforilado ou total (banda superior) e PRLR-Cluc fosforilado ou total (banda inferior). B, alterações dependentes da concentração de PRL na complementação. Após a bioluminescência basal ter sido determinada em células & # x003b32A-JAK2-PRLR-Nluc / PRLR-Cluc, foi adicionada PRL nas concentrações indicadas e a bioluminescência foi determinada em série em intervalos de 5 minutos ao longo de 40 minutos. Os dados são expressos como média & # x000b1 SE de sinal induzido por PRL como uma porcentagem acima do sinal de linha de base (n = 3 por condição). Para PRL 100-ng / mL vs PRL 250-ng / mL ou PRL 500-ng / mL, P & # x0003c .05 em cada ponto de tempo, respectivamente. Para 250-ng / mL PRL vs 500-ng / mL PRL, P & # x0003c .05 a 35 e 40 minutos. C, mudanças dependentes da concentração de GH na complementação. Após a bioluminescência basal ter sido determinada em células & # x003b32A-JAK2-PRLR-Nluc / PRLR-Cluc, foi adicionado GH nas concentrações indicadas e a bioluminescência foi determinada em série. Consulte Materiais e métodos para obter detalhes. Para GH 100-ng / mL vs GH 500-ng / mL, P & # x0003c .05 em cada ponto de tempo. Para 100-ng / mL GH vs 250-ng / mL GH, P & # x0003c .05 em 25 e 30 minutos. D, antagonista específico de PRLR, G129R, inibe a ativação de JAK2 induzida por GH e PRL em células & # x003b32A-JAK2-PRLR-Nluc / PRLR-Cluc. Pré-incubação: & # x000b1G129R (20 & # x003bcg / mL). Tratamento: & # x000b1GH ou PRL. Imunoblot de extratos celulares para JAK2 fosforilado e total. E, G129R sozinho não afeta a complementação basal de PRLR-PRLR. As células & # x003b32A-JAK2-PRLR-Nluc / PRLR-Cluc foram pré-incubadas com veículo ou G129R por 30 minutos, após o que a bioluminescência foi determinada. Os dados são exibidos graficamente como fluxo total médio & # x000b1 SE (fótons / s & # x000d7 1000). Nenhuma diferença significativa foi detectada (n = 12 por condição). F, antagonista específico de PRLR, G129R, inibe alterações induzidas por PRL na complementação de PRLR-PRLR. As células & # x003b32A-JAK2-PRLR-Nluc / PRLR-Cluc foram pré-incubadas & # x000b1 G129R e seguidas por tratamento com PRL (500 ng / ml), após o qual a bioluminescência foi determinada em série. Consulte Materiais e métodos para obter detalhes. Para PRL vs PRL + G129R, P & # x0003c .05 em cada ponto de tempo. G, antagonista específico de PRLR, G129R, inibe as alterações induzidas por GH na complementação de PRLR-PRLR. As células & # x003b32A-JAK2-PRLR-Nluc / PRLR-Cluc foram pré-incubadas & # x000b1 G129R e seguidas por tratamento com GH (500 ng / ml), após o qual a bioluminescência foi determinada em série. Consulte Materiais e métodos para obter detalhes. Para GH vs GH + G129R, P & # x0003c .05 em cada ponto de tempo.

Porque hPRLR é engajado por PRL e GH (Tabela 1), testamos os efeitos do ligante na complementação de PRLR-Nluc / PRLR-Cluc em experimentos de curso de tempo com concentrações variáveis ​​de PRL (Figura 2 B) e GH (Figura 2 C). Em cada caso, após a detecção da bioluminescência basal, o ligante foi adicionado às células & # x003b32A-JAK2-PRLR-Nluc / PRLR-Cluc e a bioluminescência foi medida sequencialmente em intervalos de 5 minutos durante 40 minutos. A PRL aumentou rapidamente a bioluminescência basal de uma forma dependente da dose, aumentando em média cerca de 45% após 15 minutos com 500 ng / mL de PRL. Depois disso, o sinal diminuiu para aproximadamente 30% & # x0201335% acima do valor basal em 30 & # x0201340 minutos. (Figura 2 B). Como a PRL, o tratamento com GH também aumentou a complementação de PRLR-Nluc / PRLR-Cluc de forma dependente da dose em quase 70% após 15 minutos com 500 ng / mL de GH (Figura 2 C). Esses padrões eram uma reminiscência daqueles vistos anteriormente para o tratamento de GH de células que expressam GHR-Nluc / GHR-Cluc (44) e da mesma forma sugerem que tanto PRL quanto GH aumentam a aproximação das caudas C-terminais de PRLR-Nluc e PRLR-Cluc dentro um dímero PRLR pré-formado.

Tabela 1.

Sítios de ligação de ligantes e antagonistas contra dímeros receptores

G129R é um mutante de hPRL com o resíduo de glicina na posição 129 de PRL substituído por arginina, o efeito líquido é reduzir a afinidade de ligação do sítio 2 de PRL para PRLR e, assim, G129R se comporta como um antagonista específico de PRLR (58, 59), tanto para GH e PRL (Tabela 1). Como esperado, o tratamento de células & # x003b32A-JAK2-PRLR-Nluc / PRLR-Cluc com o próprio G129R não desencadeou a sinalização, no entanto, G129R bloqueou completamente a fosforilação de JAK2 induzida por GH e PRL (Figura 2 D). Consistente com esses dados de sinalização, o próprio G129R não alterou a complementação basal de PRLR-Nluc / PRLR-Cluc (Figura 2 E), mas bloqueou completamente o aumento de PRLR- induzido por PRL (Figura 2 F) e induzido por GH (Figura 2 G) Complementação de Nluc / PRLR-Cluc. Isso sugere fortemente que o aumento da complementação de PRLR-Nluc / PRLR-Cluc induzido pelo ligante reflete os eventos proximais da ativação de PRLR após a ligação do ligante.

Interação GHR-PRLR e hetero-complementação

Em células de câncer de mama humano T47D que expressam endogenamente GHR e PRLR, os 2 receptores são especificamente coimmunoprecipitados independentemente da ligação do ligante (42), sugerindo que GHR e PRLR interagem em células intactas, embora a estequiometria e arquitetura dos complexos GHR-PRLR sejam desconhecidas . Buscamos esta associação ainda com nosso ensaio de complementação de luciferase dividido, empregando células & # x003b32A-JAK2 que expressam de forma estável PRLR-Nluc (& # x003b32A-JAK2-PRLR-Nluc) (Figura 3 A). & # x003b32A-JAK2-PRLR-Nluc células foram transitoriamente transfectadas com GHR-Cluc, PRLR-Cluc, EPOR-Cluc ou ER-Cluc. Como esperado, a expressão de PRLR-Cluc resultou em complementação específica substancial de PRLR-Nluc / PRLR-Cluc. Notavelmente, complementação semelhante foi observada com a coexpressão PRLR-Nluc / GHR-Cluc. Isso é consistente com nossos achados de coimunoprecipitação GHR-PRLR anteriores.

Hetero-complementação de luciferase específica de PRLR-luc com GHR-luc e o efeito dos ligantes. A, Complementação específica de luciferase de PRLR-Nluc com GHR-Cluc. Células & # x003b32A-JAK2-PRLR-Nluc foram transitoriamente transfectadas com plasmídeos de expressão que codificam as quimeras indicadas. A bioluminescência foi determinada em triplicado (a inserção mostra os sinais codificados por cores reais) e é exibida graficamente como fluxo total médio & # x000b1 SE (fótons / s & # x000d7 1000). Para GHR-Cluc vs EPOR-Cluc ou ER-Cluc, P & # x0003c .05. Para PRLR-Cluc vs EPOR-Cluc ou ER-Cluc, o valor foi P & # x0003c .05. Consulte Materiais e métodos para obter detalhes. B, Caracterização de células duplas estáveis ​​GNR-Nluc e PRLR-Cluc. Células privadas de soro & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc foram tratadas com & # x000b1 GH ou PRL. Painel esquerdo, extratos de células de detergente foram imuno-precipitados com anti-GHR (anti-GHRcyt-AL47) ou anti-PRLR (anti-PRLRcyt-AL84), resolvido por SDS-PAGE e sequencialmente immunoblotted com anti-pY e anti-GHR (anti-GHRcyt-AL47) ou anti-PRLR (anti-PRLRcyt-AL84) Painel direito, Immunoblot de extratos celulares para STAT5 fosforilado e total e STAT3 fosforilado e total. C, mudanças dependentes da concentração de GH na hetero-complementação. Após a bioluminescência basal ter sido determinada em células & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc, foi adicionado GH nas concentrações indicadas e a bioluminescência foi determinada em série. Consulte Materiais e métodos para obter detalhes. Para 50-ng / mL GH vs 100-ng / mL GH, P & # x0003c .05 em cada ponto de tempo de 20 a 40 minutos. Para 50-ng / mL GH vs 250-ng / mL GH, P & # x0003c .05 em cada ponto de tempo, exceto 10 e 15 minutos. Para 50-ng / mL GH vs 500-ng / mL GH, P & # x0003c .05 em cada ponto de tempo, exceto 5 minutos. Para 50-ng / mL GH vs 1000-ng / mL GH, P & # x0003c .05 em cada ponto de tempo, exceto 5 minutos. Para 100-ng / mL GH vs 250-ng / mL GH, P & # x0003c .05 em cada ponto de tempo, exceto 10 e 15 minutos. Para GH 100-ng / mL vs GH 500-ng / mL, P & # x0003c .05 em cada ponto de tempo, exceto 5 minutos. Para GH 100-ng / mL vs GH 1000-ng / mL, P & # x0003c .05 em cada ponto de tempo, exceto 5 minutos. Para 250-ng / mL GH vs 500-ng / mL GH ou 1000-ng / mL GH, P & # x0003c .05 em cada ponto de tempo. D, alterações dependentes da concentração de PRL na hetero-complementação. Após a bioluminescência basal ter sido determinada em células & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc, foi adicionada PRL nas concentrações indicadas e a bioluminescência foi determinada em série. Consulte Materiais e métodos para obter detalhes. Para 50-ng / mL PRL vs 100 & # x02013ng / mL PRL, P & # x0003c .05 em 25, 30 e 40 minutos. Para PRL 50-ng / mL vs PRL 250-ng / mL ou PRL 500-ng / mL, P & # x0003c .05 em cada ponto de tempo, exceto 5 minutos. Para PRL 50-ng / mL vs PRL 1000-ng / mL, P & # x0003c .05 em cada ponto de tempo. Para PRL 100-ng / mL vs PRL 250-ng / mL ou PRL 500-ng / mL ou PRL 1000-ng / mL, P & # x0003c .05 em cada ponto de tempo. Para 250-ng / mL PRL vs 500-ng / mL PRL, P & # x0003c .05 a 20 e 25 minutos. Para 250-ng / mL PRL vs 1000-ng / mL PRL, P & # x0003c .05 de 10 a 25 minutos.

Como o GH ativa tanto o GHR quanto o PRLR, concluímos que a associação GHR-PRLR pode ter consequências biologicamente relevantes. Para entender melhor a natureza do heterômero GHR-PRLR e os efeitos do tratamento com ligante, nós isolamos células & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc que expressam estavelmente GHR-Nluc e PRLR-Cluc e exibem complementação substancial de luciferase basal (dados não mostrados). Como previsto, GH desencadeou a fosforilação de GHR-Nluc e PRLR-Cluc, e PRL apenas desencadeou a fosforilação de PRLR-Cluc (Figura 3 B, painel esquerdo). Da mesma forma, GH e PRL acionaram a sinalização celular STAT3 e STAT5 (Figura 3 B, painel direito). Assim, tanto o GHR-Nluc quanto o PRLR-Cluc são amplamente expressos na superfície celular e normalmente permitem o engajamento do ligante e a ativação da sinalização nessas células.

Em seguida, examinamos os efeitos do tratamento com GH ou PRL na complementação de GHR-Nluc / PRLR-Cluc. Notavelmente, e em nítido contraste com o aumento da complementação por GH em células GHR-Nluc / GHR-Cluc e PRLR-Nluc / PRLR-Cluc, o tratamento de GH de & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc produziu amplamente uma declínio dependente da dose na complementação ao longo de uma duração de tratamento de 40 minutos, mais notável após 15 minutos (Figura 3 C). Isto sugere que um heterômero GHR-PRLR se comporta de maneira bastante diferente em resposta ao GH do que um homodímero GHR-GHR ou um homodímero PRLR-PRLR. Em princípio, um arranjo possível do heterômero está na forma de um heterodímero GHR-PRLR per se. Isso implicaria que o GH poderia se ligar aos parceiros do heterodímero para, de alguma forma, efetuar a separação de suas caudas e a diminuição da complementação resultante. No entanto, outro arranjo possível seria que o heterômero é composto de homodímeros GHR-Nluc / GHR-Nluc e homodímeros PRLR-Cluc / PRLR-Cluc em um complexo hetero-oligomérico. Neste caso, a complementação basal resultaria da interação de GHR-Nluc com PRLR-Cluc, cada um dentro de homodímeros próximos, e a ligação de GH a cada homodímero resultaria nas caudas do receptor não complementar dentro dos dímeros se movendo mais perto, mas as caudas complementares entre os dímeros se movendo longe um do outro, diminuindo assim o sinal de complementação. Para testar isso, perguntamos qual efeito o tratamento com PRL teria, raciocinando que a PRL não pode envolver um heterodímero GHR-PRLR ou um homodímero GHR-GHR, mas apenas um homodímero PRLR-PRLR. Curiosamente, o tratamento com PRL de células & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc (Figura 3 D) resultou em um declínio dependente da dose na complementação, muito semelhante ao observado em resposta ao GH, favorecendo a hipótese de que o GHR- A montagem de PRLR envolvida por ambos os ligantes é um dos dímeros heteroméricos GHR-GHR e PRLR-PRLR, em vez de heterodímeros GHR-PRLR. Este conjunto heteromérico pode ser representado como um multímero (GHR-GHR) x / (PRLR-PRLR) y, onde os níveis de expressão de cada receptor podem definir xey e, portanto, a estequiometria do complexo (por exemplo, um dímero de dímeros se x = y = 1, mas um hexâmero incluindo 3 dímeros se x = 1 ey = 2, por exemplo).

Efeitos de antagonistas de GHR e PRLR na hetero-complementação de GHR-PRLR

G120R é um mutante de hGH com uma substituição de Gly-para-Arg no resíduo 120. Esta substituição resulta em afinidade de ligação ao local 2 dramaticamente reduzida para interação com GHR e PRLR, mas a afinidade de ligação do local 1 permanece intacta, portanto, G120R funciona como um antagonista contra ambos GHR e PRLR (Tabela 1) (60). B2036 é outro análogo de hGH com uma alteração de Gly-para-Lys no resíduo 120 que reduz a afinidade de ligação do local 2, juntamente com substituições de 8 aminoácidos no local de ligação 1 que aumentam especificamente a afinidade de ligação do local 1 para GHR, resultando em um GHR- antagonista específico (Tabela 1) (61). Como acima, G129R é um mutante PRL com uma substituição de Gly-para-Arg no resíduo 129 (local 2) que se comporta como um antagonista específico de PRLR de GH e PRL (Tabela 1) (58, 59). Testamos os efeitos de cada um desses antagonistas, G120R, B2036 e G129R, na hetero-complementação GHR / PRLR em células & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc. Notavelmente, nenhum dos antagonistas, cada um dos quais tem apenas um local capaz de se ligar a GHR (G120R e B2036) ou PRLR (G120R e G129R), alterou a complementação basal de GHR-Nluc / PRLR-Cluc (Figura 4 A), confirmando que única a ligação do local não é suficiente para reduzir ou aumentar a proximidade das caudas distais dentro dos heterômeros.

Efeito de antagonistas na hetero-complementação de GHR-PRLR. A, Nem o antagonista específico de GHR, B2036, o antagonista específico de PRLR, G129R, nem o antagonista de GHR e PRLR geral, G120R, afetam a hetero-complementação basal de GHR-PRLR. Células & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc foram tratadas com veículo, B2036, G129R ou G120R por 30 minutos, após o que a bioluminescência foi determinada. Os dados são exibidos graficamente como fluxo total médio & # x000b1 SE (fótons / s & # x000d7 1000). Nenhuma diferença significativa foi detectada (n = 9 por condição). B, Efeito de G129R na mudança de hetero-complementação de GHR-PRLR induzida por PRL. Células privadas de soro & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc foram pré-incubadas com ou sem G129R e depois tratadas com PRL (500 ng / ml). A bioluminescência foi medida em série a partir daí. Consulte Materiais e métodos para obter detalhes. Para PRL vs PRL + G129R, P & # x0003c .05 em cada ponto de tempo. C, Efeito de G120R na mudança de hetero-complementação GHR-PRLR induzida por GH. Células privadas de soro & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc foram pré-incubadas com ou sem G120R e depois tratadas com GH (500 ng / ml). A bioluminescência foi medida em série a partir daí. Consulte Materiais e métodos para obter detalhes. Para GH vs GH + G120R, P & # x0003c .05 em cada ponto de tempo, exceto 5 minutos. D, Comparação dos efeitos de G129R e B2036 na mudança de hetero-complementação GHR-PRLR induzida por GH. Células privadas de soro & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc foram pré-incubadas & # x000b1 G129R ou B2036 e depois tratadas com GH (500 ng / ml). A bioluminescência foi medida em série a partir daí. Consulte Materiais e métodos para obter detalhes. A curva com linha tracejada e círculos sólidos reflete o efeito de GH na presença de G129R, presumivelmente via ligação de GH a homodímeros de GHR-GHR. A curva com linha sólida e círculos vazios reflete o efeito de GH na presença de B2036, presumivelmente via ligação de GH a PRLR- Homodímeros PRLR. A curva com linha sólida e triângulos vazios foi gerada combinando matematicamente o valor em cada ponto de (GH + B2036) com o de (GH + G129R), portanto, nenhuma barra de erro foi aplicada. Este rastreamento de combinação quase se sobrepôs ao rastreamento experimental refletindo mudanças induzidas por GH (linha tracejada e triângulos sólidos), sugerindo que o efeito de GH na hetero-complementação é o efeito líquido de sua ligação independente a homodímeros de GHR-GHR e homodímeros de PRLR-PRLR. E, as mudanças de complementação induzidas por GH através de cada receptor são proporcionais à abundância relativa dos receptores em diferentes células de clones estáveis. No painel esquerdo, os lisados ​​celulares de 2 clones estáveis ​​GHR-Nluc / PRLR-Cluc (células & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc e células & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc-2) foram resolvido por SDS-PAGE e sequencialmente immunoblotted com anti-GHR (anti-GHRcyt-AL47) e com anti-PRLR (anti-PRLRcyt-AL84) As células & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc-2 tinham uma razão de GHR para PRLR mais alta do que & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc. Painel direito, gráficos de barras empilhadas que mostram os efeitos dos antagonistas na hetero-complementação nos clones estáveis ​​2 GHR-Nluc / PRLR-Cluc no tempo 40 minutos após o tratamento com GH (500 ng / ml). Barra preta, efeito de GH via homodímeros de PRLR-PRLR, o valor foi calculado como a mudança de complementação de (GH + B2036) dividida por aquela de GH. Barra cinza, efeito de GH via homodímeros de GHR-GHR, o valor foi calculado como a mudança de complementação de (GH + G129R) dividida por aquela de GH. Observe que a soma das 2 frações é aproximadamente 1 em cada clone. Cada barra combina dados de 4 experimentos independentes e é exibida como média de fração & # x000b1 SE. Observe que & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc-2, com uma proporção maior de GHR para PRLR do que & # x003b32A-JAK2-GHR-Nluc / PRLR-Cluc, também teve uma proporção maior de alteração de complementação via GHR Homodímeros -GHR (GH + G129R).

Também testamos os efeitos dos antagonistas nas alterações de complementação de GHR-Nluc / PRLR-Cluc induzidas por ligante. Embora não tenha afetado a hetero-complementação basal, G129R inibiu completamente o declínio induzido por PRL da complementação de GHR-Nluc / PRLR-Cluc (Figura 4 B), consistente com a conclusão de que a diminuição induzida por PRL é através de sua ligação ao PRLR Homodímeros -PRLR dentro de um multímero (GHR-GHR) x / (PRLR-PRLR) y.

Em contraste com PRL, GH pode envolver tanto GHR-GHR quanto PRLR-PRLR. Consistente com isso, o efeito de GH na complementação de GHR-Nluc / PRLR-Cluc foi totalmente evitado por G120R, que bloqueia a ligação de GH a ambos os receptores (Figura 4 C). Notavelmente, a inibição seletiva da ligação de GH a GHR (com B2036) versus PRLR (com G129R) alterou as alterações de complementação de GHR-Nluc / PRLR-Cluc induzidas por GH de maneiras diferentes (Figura 4 D). Em princípio, o antagonismo de B2036 da ligação de GH a homodímeros de GHR-GHR não deve prejudicar a ligação de GH a homodímeros de PRLR-PRLR, portanto, os efeitos na hetero-complementação de (GH + B2036) são alterações induzidas por GH via homodímeros de PRLR-PRLR (Figura 4 D). Da mesma forma, o antagonismo de G129R da ligação de GH a homodímeros de PRLR-PRLR não deve prejudicar a ligação de GH a homodímeros de GHR-GHR, portanto, os efeitos na hetero-complementação de (GH + G129R) são alterações induzidas por GH via homodímeros de GHR-GHR (Figura 4 D) . Raciocinamos que as mudanças induzidas por GH na hetero-complementação são as mudanças líquidas de sua ligação independente a cada homodímero de receptor. Para resolver isso, matematicamente & # x0201ccombined & # x0201d GH's efeito por meio de sua ligação a PRLR-PRLR homodímeros (GH + B2036) com isso por meio de sua ligação a GHR-GHR (GH + G129R) e plotado um & # x0201cbination trace, & # x0201d que representa os efeitos líquidos da ligação de GH a cada homodímero de receptor (Figura 4 D). Curiosamente, o efeito de GH combinado virtualmente se sobrepôs ao traçado experimental decorrente do tratamento com GH sozinho (Figura 4 D), apoiando fortemente o modelo de multímero (GHR-GHR) x / (PRLR-PRLR) y.

Para prosseguir com esta ideia, isolamos e testamos um clone transfectante separado que coexpressa GHR-Nluc e PRLR-Cluc. In this clone, designated 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-2 cells, the ratio of GHR-Nluc to PRLR-Cluc is greater than that in JAK2-GHR-Nluc/PRLR-Cluc cells by immunoblotting ( Figure 4 E, left panel). Intriguingly, consistent with its greater GHR-Nluc to PRLR-Cluc ratio, 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-2 has a greater proportion of GH's effect via GHR-GHR homodimers (GH+G129R) vs its effect via PRLR-PRLR homodimers (GH+B2036) than seen in 𻌪-JAK2-GHR-Nluc/PRLR-Cluc ( Figure 4 E, right panel). Collectively, these data suggest a (GHR-GHR)x/(PRLR-PRLR)y multimer model, in which GHR-GHR and PRLR-PRLR homodimers are activated independently by their corresponding ligands and in proportion relative to the relationship between x and y. In contrast, these data do not support a scenario in which biofunctional GHR-PRLR heterodimers form and are activated per se by GH.

Effects of a novel GHR-PRLR agonist on GHR-PRLR hetero-complementation

B-G is a recombinant protein in which B2036 and G129R are fused in tandem with B2036 situated N-terminal to G129R ( Figure 5 A) this combined GHR-PRLR antagonist, by virtue of possessing single binding sites for each receptor ( Table 1 ), can be an agonist in cells that express both GHR and PRLR, but not in cells expressing only GHR or PRLR (49). Indeed, B-G treatment of our 𻌪-JAK2-GHR-Nluc/PRLR-Cluc cells resulted in acute tyrosine phosphorylation of both GHR and PRLR, as well as phosphorylation of STAT3 ( Figure 5 B), suggesting that both receptors are engaged by B-G. As expected, B-G treatment did not alter complementation in cells expressing GHR-Nluc/GHR-Cluc or PRLR-Nluc/PRLR-Cluc (data not shown). In contrast, B-G acutely and dose dependently augmented GHR/PRLR hetero-complementation in 𻌪-JAK2-GHR-Nluc/PRLR-Cluc cells ( Figure 5 C). We emphasize that this B-G-induced pattern is dramatically different from that observed with either GH ( Figure 3 C) or PRL ( Figure 3 D) in the hetero-complementation setting. The augmentation of GHR-Nluc/PRLR-Cluc complementation from B-G was completely inhibited by either B2036 alone or G129R alone ( Figure 5 D), confirming that B-G engages both GHR and PRLR to affect GHR-PRLR heteromer complementation. In the context of the data presented in Figures 3 and ​ and4, 4 , the data with B-G in Figure 5 may conform with the (GHR-GHR)x/(PRLR-PRLR)y multimer model, in that B-G binds to 1 GHR monomer within a GHR-GHR dimer and to 1 PRLR monomer within a nearby PRLR-PRLR dimer in the hetero-multimer. This B-G binding is envisioned to exert different effects on intracellular tail approximation (bringing GHR-Nluc within one GHR-Nluc-GHR-Nluc dimer into proximity with PRLR-Cluc within a PRLR-Cluc-PRLR-Cluc dimer to augment complementation) compared to GH or PRL (each bringing monomers within homodimers together and separating homodimers within the hetero-multimers).

Effect of a novel GHR-PRLR agonist on GHR-PRLR hetero-complementation. A, Diagram of B-G: a novel GHR-PRLR agonist. B2036 and G129R are fused in tandem with a single binding site (site 1, in red) on B2036 for GHR and a single binding site (site 1, in yellow) on G129R for PRLR, respectively. Yellow “X” indicates the mutated site 2 of GH on B2036 or mutated site 2 of PRL on G129R. B, Agonist B-G induces phosphorylation of GHR and PRLR and triggers cellular signaling in 𻌪-JAK2-GHR-Nluc/PRLR-Cluc cells. Treatment: ଛ-G. Detergent cell extracts were immuno-precipitated with anti-GHR (anti-GHRcyt-AL47) (upper panel) or anti-PRLR (anti-PRLRcyt-AL84) (middle panel), resolved by SDS-PAGE and sequentially immunoblotted with anti-pY and anti-GHR (anti-GHRcyt-AL47) or anti-PRLR (anti-PRLRcyt-AL84) Lower panel, Immunoblot of cell extracts for phosphorylated and total STAT3. C, B-G induces concentration-dependent augmentation in hetero-complementation. After basal bioluminescence was determined in 𻌪-JAK2-GHR-Nluc/PRLR-Cluc cells, B-G at indicated concentrations was added, and bioluminescence was serially determined. See Materials and Methods for details. For 0.5-μg/mL B-G vs 1-μg/mL B-G, P < .05 at each time point except 35 minutes. For 0.5-μg/mL B-G vs 5-μg/mL B-G or 10-μg/mL B-G, P < .05 at each time point. For 1-μg/mL B-G vs 5-μg/mL B-G or 10-μg/mL B-G, P < .05 at each time point except 35 and 40 minutes. For 5-μg/mL B-G vs 10-μg/mL B-G, P < .05 at 5 minutes. D, G129R or B2036 each completely antagonizes B-G-induced hetero-complementation changes. Serum-starved 𻌪-JAK2-GHR-Nluc/PRLR-Cluc cells were preincubated ± G129R or B2036 and then treated ± B-G (1 μg/mL). Bioluminescence was measured serially thereafter. See Materials and Methods for details. For B-G vs B-G+G129R or B-G+B2036, P < .05 at each time point.


Types of DNA binding domains with examples - Zinc finger, Leucine Zipper, Helix loop Helix

DNA binding proteins interact with DNA by means of various structural motifs, and can stimulate or repress transcription of messenger RNA, depending on the properties and location of the DNA sequence to which they bind.

  • This protein consists of three linked alpha helices (helices 1, 2and 3). Helices 2 and 3 are arranged in a conspicuous helix turn helix motif.
  • A 60 amino acid long region (homeodomain) within helix 3 binds specifically to DNA segments that contain the sequence 5’ATTA3’

II) Zinc finger protein :


Examples of Zinc finger proteins are:
a) Transcription factor IIIA(TFIIIA), which engages RNA polymerase II to the gene promoter
b) Sp1(First described for its action on the SV40 promoter), which engages RNA polymerase II to the gene promoter by binding to the GC box
c) Glucocorticoid receptor, estrogen receptor, progesterone receptor, thyroid hormone receptor (erbA), retinoid acid receptor, and the vitamin D3 receptor.


Molecular controls of lymphatic VEGFR3 signaling

Objetivos. Vascular endothelial growth factor receptor 3 (VEGFR3) plays important roles both in lymphangiogenesis and angiogenesis. On stimulation by its ligand VEGF-C, VEGFR3 is able to form both homodimers as well as heterodimers with VEGFR2 and activates several downstream signal pathways, including extracellular signal-regulated kinases (ERK)1/2 and protein kinase B (AKT). Despite certain similarities with VEGFR2, molecular features of VEGFR3 signaling are still largely unknown.

Abordagem e resultados: Human dermal lymphatic endothelial cells were used to examine VEGF-C-driven activation of signaling. Compared with VEGF-A activation of VEGFR2, VEGF-C-induced VEGFR3 activation led to a more extensive AKT activation, whereas activation of ERK1/2 displayed a distinctly different kinetics. Furthermore, VEGF-C, but not VEGF-A, induced formation of VEGFR3/VEGFR2 complexes. Silencing VEGFR2 or its partner neuropilin 1 specifically abolished VEGF-C-induced AKT but not ERK activation, whereas silencing of neuropilin 2 had little effect on either signaling pathway. Finally, suppression of vascular endothelial phosphotyrosine phosphatase but not other phosphotyrosine phosphatases enhanced VEGF-C-induced activation of both ERK and AKT pathways. Functionally, both ERK and AKT pathways are important for lymphatic endothelial cells migration.

Conclusões: VEGF-C activates AKT signaling via formation of VEGFR3/VEGFR2 complex, whereas ERK is activated by VEGFR3 homodimer. Neuropilin 1 and vascular endothelial phosphotyrosine phosphatase are involved in regulation of VEGFR3 signaling.

Palavras-chave: NRP1 NRP2 VE-PTP VEGF-C VEGFR2 VEGFR3.

© 2014 American Heart Association, Inc.

Declaração de conflito de interesse

Disclosure: The authors have declared that no conflict of interest exists.

Figuras

Figure 1. Comparison of VEGFR2 and VEGFR3…

Figure 1. Comparison of VEGFR2 and VEGFR3 signaling

Figure 2. VEGFR2 is involved in VEGF-C-induced…

Figure 2. VEGFR2 is involved in VEGF-C-induced AKT but not ERK activation

Figure 3. NRP1 but not NRP2 is…

Figure 3. NRP1 but not NRP2 is required for VEGF-C signaling

Figure 4. VE-PTP negatively regulates VEGFR3 signaling…

Figure 4. VE-PTP negatively regulates VEGFR3 signaling and endocytosis

Figure 5. VEGFR2 and NRP1 but not…

Figure 5. VEGFR2 and NRP1 but not VE-PTP or NRP2 are required for VEGF-C-induced cell…


MATERIAIS E MÉTODOS

Hairpin, double-stranded and monomolecular and bimolecular quadruplex DNA structures

Nucleotide sequences of synthetic DNA oligomers (products of Sigma/Genosys Rehovot, Israel) represented guanine-rich segments of promoter regions of the α7 integrin and sarcomeric mitochondrial creatine kinase (sMtCK) genes ( 35), included the core E-box DNA sequence or encoded the basic regions of MyoD or Myogenin ( Table 1). Following purification of the single-stranded oligonucleotides by denaturing gel electrophoresis in 8.0 M urea, 12% polyacrylamide (acryl/bisacrylamide, 19:1) ( 37), their 5′ ends were labeled by 32 P in bacteriophage T4 polynucleotide kinase (PNK)-catalyzed reaction ( 38). Hairpin, monomolecular and bimolecular tetraplex structures of the integrin and sMtCK DNA oligomers were formed as we described ( 35). E-box or basic region encoding DNA duplexes were prepared by annealing under described conditions ( 39) equimolar amounts of 5′ and 3′ complementary oligomers.

DNA oligomers used in this study

Oligomer designation . Bases . Nucleotide sequence .
Integrin DNA 26 5′-d(CAT GGGGG C GGG AA GGGG C GGGG TCT)-3′
sMtCK DNA 24 5′-d(CTGA GG UMA GGGG CT GG UMA GGG ACCAC)-3′
5′ E-box 26 5′-d(TCGATCCCCCAA CACCTG CTGCCTGA)-3′
3′ E-box 26 5′-d(TCAGGCAG CAGGTG TTGGGGGACGA)-3′
5′- Myogenin basic region 89 5′-d(CAAGGCGTGTAAGAGGAAGTCTGTGTCTGTGGACCGGCGGAGGGCAG CCACACTGAGGGAGAAGCGCAGGCTCAGCAAAGT GAATGAGG)-3′
3′- Myogenin basic region 91 5′-d(TCATTCACTTTGCTGAGCCTGCGCTTCTCCCTCAGTGTGGCTGCCCTCC GCCGGTCCACAGACACAGACTTCCTCTTACACGCCTTG CATG )-3′
5′- MyoD basic region 89 5′-d(CAAGGTGTGCAAGCGCAAGACCACCAACGCTGATCGCCGCAAGGCCG CCACCATGCGCGAGCGCCGCCGCCTGAAGAAAGTGAATGAGG)-3′
3′- MyoD basic region 91 5′-d(TCATTCACTTTCTTCAGGCGGCGGCGCTCGCGCATGGTGGCGGCCTTGC GGCGATCAGCGTTGGTGGTCTTGCGCTTGCACACCTTG CATG )-3
Oligomer designation . Bases . Nucleotide sequence .
Integrin DNA 26 5′-d(CAT GGGGG C GGG AA GGGG C GGGG TCT)-3′
sMtCK DNA 24 5′-d(CTGA GG UMA GGGG CT GG UMA GGG ACCAC)-3′
5′ E-box 26 5′-d(TCGATCCCCCAA CACCTG CTGCCTGA)-3′
3′ E-box 26 5′-d(TCAGGCAG CAGGTG TTGGGGGACGA)-3′
5′- Myogenin basic region 89 5′-d(CAAGGCGTGTAAGAGGAAGTCTGTGTCTGTGGACCGGCGGAGGGCAG CCACACTGAGGGAGAAGCGCAGGCTCAGCAAAGT GAATGAGG)-3′
3′- Myogenin basic region 91 5′-d(TCATTCACTTTGCTGAGCCTGCGCTTCTCCCTCAGTGTGGCTGCCCTCC GCCGGTCCACAGACACAGACTTCCTCTTACACGCCTTG CATG )-3′
5′- MyoD basic region 89 5′-d(CAAGGTGTGCAAGCGCAAGACCACCAACGCTGATCGCCGCAAGGCCG CCACCATGCGCGAGCGCCGCCGCCTGAAGAAAGTGAATGAGG)-3′
3′- MyoD basic region 91 5′-d(TCATTCACTTTCTTCAGGCGGCGGCGCTCGCGCATGGTGGCGGCCTTGC GGCGATCAGCGTTGGTGGTCTTGCGCTTGCACACCTTG CATG )-3

The integrin and sMtCK oligomers are tetraplex-forming guanine-rich sequences derived from promoter regions of the respective genes ( 35). Underlined are guanine clusters that participate in quadruplex formation. The core E-box sequence is underlined in the 5′ and 3′ E-box complementary oligomers. Sequences representing the Myogenin and MyoD basic regions are italicized in the respective basic region 5′ and 3′ complementary oligomers and the BsmI and SphI complementing ends are underlined.

DNA oligomers used in this study

Oligomer designation . Bases . Nucleotide sequence .
Integrin DNA 26 5′-d(CAT GGGGG C GGG AA GGGG C GGGG TCT)-3′
sMtCK DNA 24 5′-d(CTGA GG UMA GGGG CT GG UMA GGG ACCAC)-3′
5′ E-box 26 5′-d(TCGATCCCCCAA CACCTG CTGCCTGA)-3′
3′ E-box 26 5′-d(TCAGGCAG CAGGTG TTGGGGGACGA)-3′
5′- Myogenin basic region 89 5′-d(CAAGGCGTGTAAGAGGAAGTCTGTGTCTGTGGACCGGCGGAGGGCAG CCACACTGAGGGAGAAGCGCAGGCTCAGCAAAGT GAATGAGG)-3′
3′- Myogenin basic region 91 5′-d(TCATTCACTTTGCTGAGCCTGCGCTTCTCCCTCAGTGTGGCTGCCCTCC GCCGGTCCACAGACACAGACTTCCTCTTACACGCCTTG CATG )-3′
5′- MyoD basic region 89 5′-d(CAAGGTGTGCAAGCGCAAGACCACCAACGCTGATCGCCGCAAGGCCG CCACCATGCGCGAGCGCCGCCGCCTGAAGAAAGTGAATGAGG)-3′
3′- MyoD basic region 91 5′-d(TCATTCACTTTCTTCAGGCGGCGGCGCTCGCGCATGGTGGCGGCCTTGC GGCGATCAGCGTTGGTGGTCTTGCGCTTGCACACCTTG CATG )-3
Oligomer designation . Bases . Nucleotide sequence .
Integrin DNA 26 5′-d(CAT GGGGG C GGG AA GGGG C GGGG TCT)-3′
sMtCK DNA 24 5′-d(CTGA GG UMA GGGG CT GG UMA GGG ACCAC)-3′
5′ E-box 26 5′-d(TCGATCCCCCAA CACCTG CTGCCTGA)-3′
3′ E-box 26 5′-d(TCAGGCAG CAGGTG TTGGGGGACGA)-3′
5′- Myogenin basic region 89 5′-d(CAAGGCGTGTAAGAGGAAGTCTGTGTCTGTGGACCGGCGGAGGGCAG CCACACTGAGGGAGAAGCGCAGGCTCAGCAAAGT GAATGAGG)-3′
3′- Myogenin basic region 91 5′-d(TCATTCACTTTGCTGAGCCTGCGCTTCTCCCTCAGTGTGGCTGCCCTCC GCCGGTCCACAGACACAGACTTCCTCTTACACGCCTTG CATG )-3′
5′- MyoD basic region 89 5′-d(CAAGGTGTGCAAGCGCAAGACCACCAACGCTGATCGCCGCAAGGCCG CCACCATGCGCGAGCGCCGCCGCCTGAAGAAAGTGAATGAGG)-3′
3′- MyoD basic region 91 5′-d(TCATTCACTTTCTTCAGGCGGCGGCGCTCGCGCATGGTGGCGGCCTTGC GGCGATCAGCGTTGGTGGTCTTGCGCTTGCACACCTTG CATG )-3

The integrin and sMtCK oligomers are tetraplex-forming guanine-rich sequences derived from promoter regions of the respective genes ( 35). Underlined are guanine clusters that participate in quadruplex formation. The core E-box sequence is underlined in the 5′ and 3′ E-box complementary oligomers. Sequences representing the Myogenin and MyoD basic regions are italicized in the respective basic region 5′ and 3′ complementary oligomers and the BsmI and SphI complementing ends are underlined.

Preparation, purification and expression of full-length and mutant recombinant MyoD, MRF4 and Myogenin

Plasmids harboring cDNA that encoded full-length unmodified member proteins of the MRF family were: pGEX-6P-MyoD (Mus musculus) ( 15) pGEX-MRF4 (Rattus norvegicus) (gift of Dr P. Muñoz-Cánoves, Center for Genomic Regulation, Barcelona, Spain) pEMSV- Myogenin (Rattus norvegicus) (contributed by Dr S.J. Tapscott, FHCRC, Seattle, WA, USA) was subcloned into a pGEX-6P vector. The pGEX4T1-E47 harboring cDNA that encoded full-length Mus musculus E47 protein was a gift of Dr A. Cano (CSIC-UAM, Madrid, Spain).

To create mutant Myogenin with basic amino acid clusters identical to those of MyoD and MRF4, an R84K mutation was introduced by PCR into the second triad using the 5′ and 3′ primers 5′-d(GTCTGTGGACCGGCGGAAGGCAGCCCACACTGAGGG)-3′ and 5′-d(CCCTCAGTGTGGGCTGCCTTCCGCCGGTCCACAGAC)-3′, respectively, and full-length pGEX-6P-Myogenin cDNA template. Following verification of the mutation by sequencing, an additional K91R mutation was introduced by PCR into the third triad using a pGEX-6P-myogenin R84K cDNA template and the respective 5′ and 3′ primers 5′-d(GCCACACTGAGGGAGAGGCGCAGGCTCAAGAAAG)-3′ and 5′(CTTTCTTGAG CCTGCGCCTCTCCCTCAGTGTGGC)-3′.

To construct chimerical MyoD, which had its native basic region replaced by a Myogenin basic region (MyoD/Myogeninb), SphI and BsmI cleavage sites were generated at positions 99 and 126, respectively, upstream and downstream to the MyoD basic region (residues 102–121). A BsmI restriction site was formed by PCR as we described ( 36) using as template GST-fused full-length MyoD cDNA in pGEX-6P and the 5′ and 3′ primers 5′-d(GCAAAGTGAATGAGGCATTCGAGACGCTCAAGC)-3′ and 5′-d(GCTTGAGCGTCTCGAATGCCTCATTCACTTTGC)-3′, respectively. Presence of the BsmI restriction site was verified by sequencing and the mutated cDNA was used as template to generate by PCR a SphI restriction site using the respective 5′ and 3′ primers 5′-d(CTGCTTGCTGTGGGCATGCAAGGCGTGCAAG)-3′ and 5′-d(CTTGCACGCCTTGCATGCCCACAGCAAGCAG)-3′. The doubly mutated MyoD DNA was cut by SphI, treated with calf intestinal phosphatase (CIP), cleaved by BsmI, resolved by gel agarose electrophoresis and isolated. Myogenin basic region 5′ and 3′ oligomers ( Table 1) that were annealed and phosphorylated at their 5′-termini by PNK were ligated into the restricted MyoD cDNA. The insert had at its ends SphI and BsmI complementary sites and 5′ and 3′ sequences that encoded MyoD residues 99–101 and 122–126, respectively whereas its core encoded the Myogenin basic region (residues 74–93). Reciprocal chimerical Myogenin that contained a MyoD basic region (Myogenin/MyoDb) was prepared as follows: GST-fused full-length Myogenin cDNA in pGEX-6P vector served as a template into which a BsmI restriction site was introduced by PCR using the 5′ and 3′ primers 5′-d(GAAAGTGAATGAGGCATTCGAGGCTCTGAAGAGAAGC)-3′ and 5′-d(GCTTCTCTTCAGAGCCTCGAATGCCTCATTCACTTTC)-3′, respectively. To have the generated BsmI site as a single a BsmI restriction sequence in the Myogenin cDNA, PCR was employed to eliminate a native site at position 486 by using the respective 5′ and 3′ primers 5′-d(CCCAGTGAATGTAACTCCCACAGCGCCTCC)-3′ and 5′-d(GGAGGCGCTGTGGGAGTTACATTCACTGGG)-3′ and the modified Myogenin cDNA template. A SphI restriction site was introduced into the mutated Myogenin cDNA template by PCR using the respective 5′ and 3′ primers 5′-d(CAGTGCCTGCCCTGGGCATGCAAGGTGTGTAAGAG)-3′ and 5′-d(CTCTTACACACCTTGCATGCCCAGGGCA GGCACTG)-3′. Restriction and isolation of linear Myogenin DNA was conducted as described for MyoD DNA. MyoD basic region 5′ and 3′ oligomers ( Table 1) were annealed, phosphorylated and ligated into the restricted Myogenin DNA as detailed above. The insert had at its ends SphI and BsmI complementary sites and 5′ and 3′ sequences that encoded Myogenin residues 71–73 and 94–98, respectively, whereas its core encoded the MyoD basic region (residues 102–121).

Recombinant unmodified or mutant proteins were expressed and purified as follows: pGEX-6P plasmids harboring the respective cDNA sequences were electroporated into competent Escherichia coli BL21 (DE3)pLysS cells that were grown in LB medium containing ampicillin and chloramphenicol to an A600 of ∼0.6. Synthesis of the GST-fused proteins was induced by exposure to 100 μM IPTG for 3 h. Purification of the recombinant proteins from the bacterial cell extracts to >95% homogeneity was attained by glutathione-agarose (Sigma) affinity column chromatography. The GST residue was cleaved from the MyoD or Myogenin fusion proteins by incubating 100 μg protein at 4°C for 4 h with 1.0 unit preScission protease (GE Healthcare, Bucks, UK). The DNA-binding capacity of Myogenin that was used in some experiments as an intact fusion protein was found to be indistinguishable from that of the preScission protease cleaved protein. MRF4 and E47 were used as uncleaved fusion proteins.

Electrophoresis mobility shift separation of protein–DNA complexes and determination of their dissociation constants

Heterodimers of MyoD, MRF4 or Myogenin with E47 were generated prior to their binding to the various DNA probes by incubating at 37°C for 10 min purified recombinant MRF protein with an equimolar amount of E47 in reaction mixtures that contained in a final volume of 10 μl: 45 mM KCl, 4.5 mM MgCl2, 0.5 mM EDTA, 1 mM DTT, 20% glycerol in 20 mM Tris–HCl buffer, pH 8.0. Protein–DNA binding was conducted in reaction mixtures that contained in a final volume of 10 μl: specified amounts of homodimeric MRF proteins or their heterodimers with E47 and 5′- 32 P labeled DNA probe, 10 mM KCl, 1.0 mM EDTA, 0.5 mM DTT, 20% glycerol in 25 mM Tris–HCl buffer, pH 8.0. Mixtures for the binding of end-labeled bimolecular tetraplex DNA structures of muscle-specific regulatory sequences were also supplemented with 10 mM KCl. The mixtures were incubated at 30°C for 20 min and protein–DNA complexes were resolved from free DNA by electrophoresis at 4°C and under 200–250 V in nondenaturing 4 or 6% polyacrylamide gel (acryl/bisacrylamide, 19:1) in 10 mM KCl in 0.25× TBE buffer (0.5 mM EDTA in 22.5 mM Tris–borate buffer, pH 8.3). Electrophoresis of the DNA was conducted until a bromophenol blue marker dye migrated 7.5 cm into the gel. The gels were dried on DE81 filter paper and the relative proportions of bands of free and protein-bound DNA were quantified by phosphor imaging analysis.

Dissociation constants, Kd, values of complexes of homodimeric MRF proteins or their heterodimers with E47 with E-box DNA or with bimolecular tetraplex structures of guanine-rich muscle-specific DNA sequences were determined as follows: increasing amounts of 32 P-labeled DNA were incubated with a constant amount of protein in the above described protein–DNA binding reaction mixtures. Following electrophoretic resolution of the protein–DNA complexes from free DNA by mobility shift, their relative amounts were determined by phosphor imaging quantification of the respective radioactive bands. Kd values were deduced from the negative reciprocal of the slope of a Scatchard plot of the results as described elsewhere ( 40).


Agradecimentos

We thank Lukasz Patyk, Froukje van der Wal and Richard Immink for assistance with the yeast two-hybrid and yeast one-hybrid assays, and the latter as well as Selahattin Danisman for useful discussions. Mrs Ruth White (Boyce Thompson Institute, Ithaca, NY) is gratefully acknowledged for sending us tomato EST clones. This work was partially funded by European Commission 6 th Framework programme project “High Quality Solanaceous crops for consumers, processors and producers by exploration of natural biodiversity” (EU-SOL contract nr. PL 016214–2), by the Dutch Ministry of Agriculture, Nature and Food Quality and the Dutch Organization for Scientific Research NWO-ALW project nr. 828.08.005.


Gene organization and evolutionary history

Peptidoglycan recognition proteins (PGRPs) are innate immunity molecules that contain a conserved peptidoglycan-binding type 2 amidase domain that is homologous to bacteriophage and bacterial type 2 amidases [1–6]. PGRPs are ubiquitous in most animals. Insects have multiple PGRP genes that are classified into short (S) and long (L) transcripts and are often alternatively spliced into up to 19 different proteins (Table 1) [1–5]. PGRPs have also been identified in mollusks, echinoderms, and vertebrates (Table 1), but plants and lower metazoa, including nematodes such as Caenorhabditis elegans, do not have PGRPs. PGRP genes usually form clusters that suggest their origin by gene duplication.

Mammals have a family of four PGRPs, which were initially named PGRP-S, PGRP-L, and PGRP-Iα and PGRP-Iβ (for 'short', 'long', or 'intermediate' transcripts, respectively), by analogy to insect PGRPs [3]. Subsequently, the Human Genome Organization Gene Nomenclature Committee changed their symbols to PGLYRP-1, PGLYRP-2, PGLYRP-3, and PGLYRP-4, respectively. This terminology is also used for mouse PGRPs, and is beginning to be adopted for all vertebrate PGRPs. In this article, the abbreviation PGRP will be used for all invertebrate members and PGLYRP for all vertebrate members of the PGRP family.

Phylogenetic analysis of insect PGRPs reveals an early separation of PGRPs into enzyme-active amidases and the remaining PGRPs, which activate signal transduction pathways and proteolytic cascades (Figure 1). PGRPs from other animals cannot easily be grouped with any individual insect PGRPs, so they are considered separately here. The non-insect PGRPs also evolved into two groups. The first group are all amidases, which in echinoderms, mollusks, fish, and amphibians are evolutionarily older and which more recently evolved into the mammalian amidases (PGLYRP-2 Figure 2). The second group are mammalian bactericidal proteins, which separated into two well defined branches: PGLYRP-1 (present in phagocytic granules) and PGLYRP-3 and PGLYRP-4 (present on skin and mucous membranes Figure 2). The only probable orthologs between non-insect and insect PGRPs are the amidase-active PGRPs (Figures 1, 2 and Table 1).

A phylogenetic tree of insect PGRPs, indicating their known and deduced functions. For branches supported by bootstrap analysis with the proportion of 1000 replications higher than 70%, the percentage is indicated. The bar indicates the p-distance. Abreviações: Ag, Anopheles gambiae Am, Apis mellifera Bm, Bombyx mori Ce, Calpodes ethlius Dm, Drosophila melanogaster Glm, Glossina morsitans Gm, Galleria mellonella Hd, Holotrichia diomphalia Ms, Manduca sexta Tm, Tenebrio molitor Tn, Trichoplusia ni. Accession numbers and references are listed in Table 1. PPO, prophenol-oxidase.

A phylogenetic tree of mollusk, echinoderm, and vertebrate PGRPs, indicating their known and deduced functions. Bootstrap analysis and p-distance indicated as in Figure 1. Abbreviations: Ai, Argopecten irradians Ar, Asterias rubens Bt, Bos taurus Cd, Camelus dromedaries Cf, Canis familiaris Dr, Danio Es, Euprymna scolopes Gg, Gallus gallus Hs, Homo sapiens Mm, Mus musculus Pt, Pan troglodytes Rn, Rattus norvegicus Sp, Strongylocentrotus purpuratus Ss, Sus scrofa Ten, Tetraodon nigroviridis Xl, Xenopus laevis Xt, Xenopus tropicalis. Accession numbers and references are listed in Table 1. The asterisk indicates that Es PGRP-4 is not a predicted amidase.


Discussão

Although no stable marker for the ERGIC is known, the continuous recycling of ERGIC-53 has allowed us to visualize the ERGIC for prolonged times in living cells and to compare the dynamics of sorting of the retrograde marker protein ERGIC-53 and the anterograde markers VSV-G and ssDsRed. Our findings shed new light on the nature of the ERGIC and on protein trafficking early in the secretory pathway. They support the notion of a stationary ERGIC consisting of numerous discontinuous elements that operate in bidirectional sorting to the ER and Golgi. This conclusion is based on three major observations. First, GFP-ERGIC-53 is localized in stationary spots displaying short-range non-directional movement. Unlike VSV-G-GFP spots, GFP-ERGIC-53 spots do not show a preferential movement toward the Golgi region and hence do not exhibit typical features of anterograde carriers (ACs). Their short-range movement is dependent on intact microtubules as it is lost in nocodazole-treated cells. Second, many of the stationary GFP-ERGIC-53 structures are long-lived and persist for more than 30 minutes, another feature that is inconsistent with an exclusive AC function. ER to Golgi transport is a rapid event. The ERGIC spots can undergo splitting and occasionally fuse with one another some appear de novo, others disappear. Interestingly, similar features have been observed for ERES (Stephens, 2003 Bevis and Glick, 2002) suggesting that the dynamics of ERES and ERGIC clusters may be regulated in concert. Third, the ERGIC spots are not consumed by the sorting of GFP-ERGIC-53 and ssDsRed. They can undergo multiple rounds of sorting of anterograde and retrograde cargo.

Our conclusion regarding the nature of the ERGIC is different from previous live-imaging studies on VSV-G-GFP transport (Presley et al., 1997 Scales et al., 1997). These authors concluded that the ERGIC clusters are transport vehicles for protein delivery to the Golgi, rather than a stable compartment (Lippincott-Schwartz et al., 2000). In accord with these studies, we observed that the ACs moving to the Golgi, containing ssDsRed (or VSV-G-GFP), are rather large and cannot be small transport vesicles. However, they derive from the stationary ERGIC defined by ERGIC-53. Only by visualization of the sorting of anterograde and retrograde traffic from the ERGIC in living cells did the stationary nature of this compartment become apparent.

Quantification of the directionality of movement by a numerical processing procedure supports our visual impression that GFP-ERGIC-53 largely escapes packaging into ACs. Unlike VSV-G-GFP, GFP-ERGIC-53 shows no preferential movement to the Golgi upon exit from the ERGIC: it moves in the opposite direction. Considering the apparently random distribution of ERGIC clusters in the peripheral cytoplasm one would expect no preferred directionality for GFP-ERGIC-53 cycling back to the ER. However, low temperature blocks tend to concentrate the ERGIC clusters closer to the Golgi apparatus (Klumperman et al., 1998). Therefore, the measured net flow for ERGIC-53 results from a combined effect: repositioning of ERGIC clusters and recycling of ERGIC-53. At first glance, the measured difference of 13.5% between anterograde and retrograde movements of VSV-G-GFP appears to be small. It should be noted, however, that the quantification time was short (10 seconds) and that extrapolation to a longer time results in a net flow to the Golgi within a few minutes. Thus, directed transport is the consequence of a slight preference in movement towards one direction. Overall, this novel vector field method based on the optical flow estimation validates previous conclusions derived from fixed cells (Klumperman et al., 1998), proposing that ERGIC to ER retrograde transport largely bypasses the Golgi. It is also consistent with our ssDsRed/GFP-ERGIC-53 dual-imaging data showing preferential sorting of anterograde and retrograde traffic in the ERGIC.

ERGIC clusters defined by ERGIC-53 and COP I are localized in close proximity to ERES (Bannykh et al., 1996 Klumperman et al., 1998 Martinez-Menarguez et al., 1999 Stephens et al., 2000), which precludes the visualization of protein transport from ERES to ERGIC in live cells owing to the insufficient resolution of light microscopy. Therefore, a simple alternative interpretation of our data would be that GFP-ERGIC-53, unlike endogenous ERGIC-53, is trapped in ERES and has no access to the ERGIC. Accordingly, the dispersal of GFP-ERGIC-53 induced by H89 could reflect diffusion within the plane of the ER membrane. Several observations argue against this interpretation. Like endogenous ERGIC-53, GFP-ERGIC-53 co-localizes with the COP I subunit β-COP but shows only partial overlap with COPII subunits, Sec13 and Sec31, in fixed cells analyzed by confocal microscopy. Likewise, our biochemical analysis indicates normal folding of GFP-ERGIC-53. Furthermore, NEM blocks the H89-induced dispersal of ERGIC-53 from the stationary structures indicating discontinuity with the ERES. The combined data suggest that the GFP-ERGIC-53 stationary structures correspond to the tubulovesicular ERGIC clusters defined by ERGIC-53 and COP I at the ultrastructural level (Schweizer et al., 1988 Klumperman et al., 1998).

By imaging at high temporal resolution of 5 frames per second (fast imaging) we have uncovered a third pathway not previously described. This pathway is mediated by fast-moving carriers (FCs) a fraction of which contains both GFP-ERGIC-53 and ssDsRed. The pathway is highly sensitive to microtubule-disrupting drugs as well as H89, and requires the existence of stationary ERGIC structures as unveiled by H89 wash-out experiments. As FCs do not exhibit preferential movement to the Golgi area and can occasionally be seen to originate from and fuse with stationary ERGIC structures, we propose that they functionally connect ERGIC clusters by lateral exchange. Although a majority of the FCs remains unsorted and appears to eventually fuse with a stationary structure, some can separate into a GFP-ERGIC-53-containing and an ssDsRed-containing dot, which move in opposite directions. The GFP-ERGIC-53 dot tends to rapidly disappear, whereas the ssDsRed dot moves to the Golgi. This suggests that some FCs are involved in anterograde/retrograde sorting.

Integrating our new data with previously published findings, the following picture regarding the organization and traffic routes in the early secretory pathway emerges (Fig. 7). Newly synthesized secretory proteins and ERGIC-53 are transported from the ER to stationary ERGIC clusters that are lying close to, but separate from ERES (Bannykh et al., 1996 Mezzacasa and Helenius, 2002). Although there is agreement that ER exit is COP II-dependent (Horstmann et al., 2002 Mironov et al., 2003), the precise mechanism of membrane traffic from ERES to ERGIC remains to be elucidated. Once in the ERGIC, anterograde cargo is sorted from ERGIC-53 into rather large ACs by a dissociative process. The size of ACs may vary according to cargo flux and can be considerable under conditions of massive synchronized release of VSV-G from the ER (Horstmann et al., 2002). ACs then rapidly move to the Golgi in a microtubule-dependent way. In contrast, ERGIC-53 is packaged into retrograde carriers (RCs), the size and shape of which can also vary. RCs must also be of a considerable size to be visible. When traffic is inhibited at 15°C followed by rewarming to 37°C, RCs emanating from the ERGIC clusters are often tubular. It appears that conditions of massive cargo transport favor the formation of tubules regardless of the pathway. Like ERGIC to Golgi anterograde transport, efficient ERGIC to ER retrograde transport requires intact microtubules.



Comentários:

  1. Huon

    Parabéns, isso é apenas um ótimo pensamento.

  2. Rahul

    Ótimo, essa é uma frase muito valiosa.

  3. Zifa

    I congratulate, what words ..., the brilliant idea

  4. Jude

    Onde aqui contra a autoridade

  5. Lindael

    Commodity Aftor, existe em melhor qualidade?



Escreve uma mensagem