Em formação

Como posso produzir quantidades em miligramas de um oligômero de DNA marcado com isótopo?

Como posso produzir quantidades em miligramas de um oligômero de DNA marcado com isótopo?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Eu gostaria de produzir uma sequência específica de DNA em uma escala de miligramas e 13C15N-rotule-o. A sequência tem cerca de 35 nucleotídeos, então a síntese química está fora de questão devido aos custos exorbitantes.

Também estou interessado apenas no DNA de fita simples, portanto, um método que produza DNA de fita dupla sem nenhuma maneira de separar facilmente as fitas também não seria útil.

Que métodos existem para produzir DNA rotulado que preenche esses requisitos?


Você também pode projetar um plasmídeo que tenha seus 35mers e aumentar as bactérias com carbono isotópico e nitrogênio C13 acetato e N15 sulfato de amônio funcionará com E. coli em um meio mínimo.

isso não é barato, mas as fontes disponíveis mais baratas de isótopos podem ser usadas.


Eu encontrei alguns métodos usando o fago M13 crescendo em E. coli:

  • Reddy P, McKenney K. Método melhorado para a produção de fago M13 e DNA de fita simples para sequenciamento de DNA. Biotécnicas. Maio de 1996; 20 (5): 854-6, 858, 860.

  • Eu Jupin e B Gronenborn. Produção abundante, fácil e reproduzível de DNA de fita simples a partir de fagemídeos usando células competentes infectadas com fago auxiliar. 11 de fevereiro de 1995; 23 (3): 535-536.

Você pode facilmente adaptar esses protocolos para crescer em meio contendo 13C e 15N. Então você poderia usar uma enzima de restrição capaz de cortar o DNA ss e purificar seu fragmento através de um gel de PA. O kit gigaprep da Clontech (até 50 mg de DNA) custará US $ 546 (nos EUA, antes de qualquer orçamento).

Disclaimer: Eu nunca fiz nada disso!


A maneira mais barata de fazer essa grande quantidade de DNA sem a necessidade de todo o oligômero sendo marcado seria produzir 34 nucleotídeos por síntese química. O 35 nucleotídeo pode ser marcado e ligado às fitas restantes. Isso deve reduzir os custos de produção do oligômero, visto que na etapa mais cara, a marcação é limitada apenas ao nucleotídeo final.


E quanto ao PCR usando nucleotídeos marcados? Pode ser necessário executar várias reações para obter as quantidades de miligramas de que você precisa, mas 35 nucleotídeos parecem realmente muito pequenos para o crescimento de bactérias, e a purificação seria extremamente difícil. Mas 35 bases podem até ser muito pequenas para PCR, pouco maiores do que seus primers.

Se você precisar crescer em e coli, pode fazer sentido criar um plasmídeo com várias repetições da sequência de 35 bases separadas pelo mesmo local de restrição. Você pode cultivar e coli em meio c13 n15, mas é caro e você "treina" as células ao longo de várias gerações porque os isótopos mais pesados ​​criam diferenças na cinética química que tornam os nutrientes marcados difíceis de serem usados ​​pelas enzimas, mas tenho visto pessoas faça isso para fazer proteínas para NMR.

Aposto que você precisa desse DNA rotulado para RMN, não é?

Você já considerou a RMN de fosfato? Não há necessidade de rotulá-lo, o P-31 já é NMR ativo. Se tiver que ser C13 N15, recomendo fortemente que seja sintetizado, será caro, mas o comprimento de 35 bases e a necessidade de fita simples são ideais para síntese química.


Purificação e caracterização de RNAs transcritos usando cromatografia de filtração em gel

Síntese de RNA usando em vitro a transcrição pela polimerase de RNA do fago T7 permite a preparação de quantidades em miligramas de RNA para investigações bioquímicas, biofísicas e estruturais. As abordagens de purificação anteriores baseavam-se em métodos de eletroforese em gel ou cromatografia de fluxo por gravidade. Apresentamos aqui um protocolo para o em vitro transcrição de RNAs e subsequente purificação usando cromatografia líquida de desempenho rápido. Este protocolo facilita muito a produção de RNA em um único dia, desde a transcrição até a purificação.


Fundamentos Científicos da Biotecnologia

1.06.11 Características Particulares da Clonagem de Oligonucleotídeos

A clonagem de oligonucleotídeos é comum na engenharia genética moderna. As inserções de plasmídeo geradas por oligonucleotídeo típicas incluem os poliligantes, locais para recombinação específica de local e sequências de codificação para pequenos domínios de proteína.

Os oligonucleotídeos de fita dupla são produzidos por emparelhamento de oligonucleotídeos de fita simples, que são sintetizados comercialmente a partir de dNTPs. A tecnologia atual permite a síntese química de oligonucleotídeos com um comprimento de até cerca de 110-120 bp (Sigma-Genosys, Invitrogen). Os oligonucleotídeos mais longos são normalmente purificados das formas abortivas contaminantes por cromatografia líquida de alta pressão ou eletroforese em gel de poliacrilamida. Como os oligonucleotídeos são relativamente curtos e, portanto, é improvável que contenham locais de reconhecimento de restrição, a seleção dos plasmídeos recombinantes pode ser realizada convenientemente por digestão com endonuclease de restrição da mistura de ligação. Após a extração do DNA do plasmídeo dos transformantes e a excisão da inserção, a inserção do oligonucleotídeo excisado pode ser analisada em um gel de agarose 1,0–2,0% ou um gel de poliacrilamida. No entanto, muitas vezes é mais fácil confirmar uma inserção de oligonucleotídeo bem-sucedida pelo ganho ou perda resultante dos locais de reconhecimento de restrição relevantes dentro de todo o plasmídeo. Esses locais de restrição podem ser incorporados ou excluídos da sequência de oligonucleótidos com o propósito específico de simplificar o rastreio do clone.

A clonagem de oligonucleotídeos se beneficia das quantidades substanciais disponíveis de DNA de oligonucleotídeo, sua pureza de fragmentos de DNA indesejados, a possibilidade de construir extremidades coesivas de escolha, a possibilidade de criar locais resistentes a nuclease de restrição alterando o nucleotídeo próximo à extremidade coesiva, e possibilidade de introduzir locais de restrição extra, se necessário. Além disso, o DNA não fosforilado é simples de obter, pois os oligonucleotídeos são fornecidos na forma não fosforilada por padrão. No entanto, existem algumas armadilhas específicas de oligonucleotídeos: oligonucleotídeos mais longos podem exigir uma purificação particularmente completa e a clonagem de oligonucleotídeos com uma estrutura secundária pronunciada pode ser complicada. Portanto, é sempre aconselhável verificar possíveis estruturas de stem-loop por software como DNAsis e bloquear essas estruturas indesejadas com algumas pequenas alterações na sequência do oligonucleotídeo projetado.


Temos experiência e especialização significativas no produção em larga escala de DNA de plasmídeo para vários usos.

Nós fabricamos DNA de plasmídeo GMP material de início para ser usado na produção de vetores virais (por exemplo, lentivírus e AAV) ou em vitro RNA transcrito (IVT-RNA) (por exemplo. mRNA, RNA longo)

Nós também produzimos plasmídeo DNA API para uso como Vacinas de DNA ou plasmídeo não viral terapêutico mediado por DNA terapia de genes formulários.

Para ensaios clínicos humanos e comercialização

Todo o material GMP é produzido de acordo com FDA 21 CFR Parte 210 e 211, EU 2003/94 / EC, Eudralex Vol 4 e ICH relevante o regulador requisitos para produtos injetáveis ​​estéreis destinados a ensaios clínicos em humanos e comercialização.

DNA de plasmídeo GMP em escala de kg

Fabricamos vacinas de DNA de plasmídeo personalizadas para terapia genética.

Nosso Fermentador de 2200L combinado com nosso processo de purificação permite a produção de DNA de plasmídeo à escala de quilos para uso comercial.


Artigo ORIGINAL RESEARCH

Nadide Altincekic 1,2 & # x02020, Sophie Marianne Korn 2,3 & # x02020, Nusrat Shahin Qureshi 1,2 & # x02020, Marie Dujardin 4 & # x02020, Mart & # x000ed Ninot-Pedrosa 4 & # x02020, Rupert Abele 5, Marie Jose Abi Saad 6, Caterina Alfano 7, Fabio C. L. Almeida 8,9, Islam Alshamleh 1,2, Gisele Cardoso de Amorim 8,10, Thomas K. Anderson 11, Cristiane D. Anobom 8,12, Chelsea Anorma 13, Jasleen Kaur Bains 1,2, Adriaan Bax 14, Martin Blackledge 15, Julius Blechar 1,2, Anja B & # x000f6ckmann 4 & # x0002a & # x02021, Louis Brigandat 4, Anna Bula 16, Matthias B & # x000fctikofer 6, Aldo R. Camacho-Zarco 15, Teresa Carlomagno 17,18, Icaro Putinhon Caruso 8,9,19, Bet & # x000fcl Ceylan 1,2, Apirat Chaikuad 20,21, Feixia Chu 22, Laura Cole 4, Marquise G. Crosby 23, Vanessa de Jesus 1,2, Karthikeyan Dhamotharan 2,3, Isabella C. Felli 24,25, Jan Ferner 1,2, Yanick Fleischmann 6, Marie-Laure Fogeron 4, Nikolaos K. Fourkiotis 26, Christin Fuks 1, Boris F & # x000fcrtig 1,2, Angelo Gallo 26, Santosh L. Gande 1,2, Juan Atilio Gerez 6, Dhiman Ghosh 6, Francisco Gomes-Neto 8,27, Oksana Gorbatyuk 28, Serafima Guseva 15, Carolin Hacker 29, Sabine H & # x000e4fner 30, Bing Hao 28, Bruno Hargittay 1,2, K. Henzler-Wildman 11, Jeffrey C. Hoch 28, Katharina F. Hohmann 1,2, Marie T. Hutchison 1,2, Kristaps Jaudzems 16, Katarina Jovi & # x00107 22, Janina Kaderli 6, Gints Kalni & # x00146 & # x00161 31, Iveta Ka & # x00146epe 16, Robert N. Kirchdoerfer 11, John Kirkpatrick 17,18, Stefan Knapp 20,21, Robin Krishnathas 1,2, Felicitas Kutz 1,2, Susanne zur Lage 18, Roderick Lambertz 3, Andras Lang 30, Douglas Laurents 32, Lauriane Lecoq 4, Verena Linhard 1,2, Frank L & # x000f6hr ​​2,33, Anas Malki 15, Luiza Mamigonian Bessa 15, Rachel W. Martin 13,23, Tobias Matzel 1,2, Damien Maurin 15, Seth W. McNutt 22, Nathane Cunha Mebus-Antunes 8,9, Vença H. Meier 6, Nathalie Meiser 1, Miguel Mompe & # x000e1n 32, Elisa Monaca 7, Roland Montserret 4, Laura Mari e # x000f1o Perez 15, Celine Moser 34, Claudia Muhle-Goll 34, Thais Cristtina Neves-Martins 8,9, Xiamonin Ni 20,21, Brenna Norton-Baker 13, Roberta Pierattelli 24,25, Letizia Pontoriero 24,25, Yulia Pustovalova 28, Oliver Ohlenschl & # x000e4ger 30, Julien Orts 6, Andrea T. Da Poian 9, Dennis J. Pyper 1,2, Christian Richter 1,2, Roland Riek 6, Chad M. Rienstra 35, Angus Robertson 14, Anderson S. Pinheiro 8,12, Raffaele Sabbatella 7, Nicola Salvi 15, Krishna Saxena 1,2, Linda Schulte 1,2, Marco Schiavina 24,25, Harald Schwalbe 1,2 & # x0002a & # x02021, Mara Silber 34, Marcius da Silva Almeida 8,9, Marc A. Sprague-Piercy 23, Georgios A. Spyroulias 26, Sridhar Sreeramulu 1,2, Jan-Niklas Tants 2,3, Kaspars T & # x00101rs 31, Felix Torres 6, Sabrina T & # x000f6ws 3, Miguel & # x000c1. Trevi & # x000f1o 32, Sven Trucks 1, Aikaterini C. Tsika 26, Krisztina Varga 22, Ying Wang 17, Marco E. Weber 6, Julia E. Weigand 36, Christoph Wiedemann 37, Julia Wirmer-Bartoschek 1,2, Maria Alexandra Wirtz Martin 1,2, Johannes Zehnder 6, Martin Hengesbach 1 & # x0002a & # x02021 e Andreas Schlundt 2,3 & # x0002a & # x02021
  • 1 Instituto de Química Orgânica e Biologia Química, Goethe University Frankfurt, Frankfurt am Main, Alemanha
  • 2 Centro de Ressonância Magnética Biomolecular (BMRZ), Goethe University Frankfurt, Frankfurt am Main, Alemanha
  • 3 Instituto de Biociências Moleculares, Goethe University Frankfurt, Frankfurt am Main, Alemanha
  • 4 Microbiologia Molecular e Bioquímica Estrutural, UMR 5086, CNRS / Universidade de Lyon, Lyon, França
  • 5 Instituto de Bioquímica, Goethe University Frankfurt, Frankfurt am Main, Alemanha
  • 6 Instituto Federal Suíço de Tecnologia, Laboratório de Físico-Química, ETH Zurique, Zurique, Suíça
  • 7 Unidade de Biologia Estrutural e Biofísica, Fondazione Ri.MED, Palermo, Itália
  • 8 Centro Nacional de Ressonância Magnética Nuclear (CNRMN, CENABIO), Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brasil
  • 9 Instituto de Bioquímica Médica, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brasil
  • 10 Centro Multidisciplinar de Pesquisa em Biologia (NUMPEX), Campus Duque de Caxias, Universidade Federal do Rio de Janeiro, Duque de Caxias, Brasil
  • 11 Institute for Molecular Virology, University of Wisconsin-Madison, Madison, WI, Estados Unidos
  • 12 Instituto de Química, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brasil
  • 13 Departamento de Química, Universidade da Califórnia, Irvine, CA, Estados Unidos
  • 14 LCP, NIDDK, NIH, Bethesda, MD, Estados Unidos
  • 15 Univ. Grenoble Alpes, CNRS, CEA, IBS, Grenoble, França
  • 16 Instituto de Síntese Orgânica da Letônia, Riga, Letônia
  • 17 BMWZ e Instituto de Química Orgânica, Leibniz University Hannover, Hannover, Alemanha
  • 18 Grupo de Química Estrutural Baseada em RMN, Helmholtz Center for Infection Research, Braunschweig, Alemanha
  • 19 Centro Multiusuários de Inovação Biomolecular (CMIB), Departamento de Física, S & # x000e3o Universidade Estadual Paulista (UNESP), S & # x000e3o Jos & # x000e9 do Rio Preto, Brasil
  • 20 Instituto de Química Farmacêutica, Goethe University Frankfurt, Frankfurt am Main, Alemanha
  • 21 Structural Genomics Consortium, Buchmann Institute for Molecular Life Sciences, Frankfurt am Main, Alemanha
  • 22 Departamento de Ciências Moleculares, Celulares e Biomédicas, University of New Hampshire, Durham, NH, Estados Unidos
  • 23 Departamento de Biologia Molecular e Bioquímica, Universidade da Califórnia, Irvine, CA, Estados Unidos
  • 24 Centro de Ressonância Magnética (CERM), Universidade de Florença, Sesto Fiorentino, Itália
  • 25 Departamento de Química & # x0201cUgo Schiff & # x0201d, Universidade de Florença, Sesto Fiorentino, Itália
  • 26 Departamento de Farmácia, Universidade de Patras, Patras, Grécia
  • 27 Laboratório de Toxinologia, Fundação Oswaldo Cruz (FIOCRUZ), Rio de Janeiro, Brasil
  • 28 Departamento de Biologia Molecular e Biofísica, UConn Health, Farmington, CT, Estados Unidos
  • 29 Signals GmbH & # x00026 Co. KG, Frankfurt am Main, Alemanha
  • 30 Leibniz Institute on Aging & # x02014Fritz Lipmann Institute (FLI), Jena, Alemanha
  • 31 Centro de Pesquisa e Estudo Biomédico da Letônia, Riga, Letônia
  • 32 & # x0201cRocasolano & # x0201d Instituto de Físico-Química (IQFR), Conselho Nacional de Pesquisa da Espanha (CSIC), Madri, Espanha
  • 33 Instituto de Química Biofísica, Goethe University Frankfurt, Frankfurt am Main, Alemanha
  • 34 IBG-4, Instituto de Tecnologia de Karlsruhe, Karlsruhe, Alemanha
  • 35 Departamento de Bioquímica e Instalação Nacional de Ressonância Magnética em Madison, University of Wisconsin-Madison, Madison, WI, Estados Unidos
  • 36 Departamento de Biologia, Universidade Técnica de Darmstadt, Darmstadt, Alemanha
  • 37 Instituto de Bioquímica e Biotecnologia, Charles Tanford Protein Center, Martin Luther University Halle-Wittenberg, Halle / Saale, Alemanha

A doença altamente infecciosa COVID-19 causada pelo Betacoronavírus O SARS-CoV-2 representa uma grave ameaça à humanidade e exige o redirecionamento dos esforços e critérios científicos para projetos de pesquisa organizados. O Internacional COVID19-NMR O consórcio procura fornecer essas novas abordagens reunindo conhecimentos científicos em todo o mundo. Em particular, disponibilizar proteínas virais e RNAs abrirá o caminho para a compreensão dos componentes moleculares do SARS-CoV-2 em detalhes. A pesquisa em COVID19-NMR e os recursos fornecidos por meio do consórcio são totalmente divulgados para acelerar o acesso e a exploração. As investigações de NMR dos componentes moleculares virais são designadas para fornecer a base essencial para trabalhos futuros, incluindo estudos de interação macromolecular e triagem de drogas de alto rendimento. Aqui, apresentamos o extenso catálogo de uma abordagem holística de preparação da proteína SARS-CoV-2 com base nos esforços coletivos do consórcio & # x02019s. Fornecemos protocolos para a produção em grande escala de mais de 80% de todas as proteínas SARS-CoV-2 ou partes essenciais delas. Várias das proteínas foram produzidas em mais de um laboratório, demonstrando a alta interoperabilidade entre grupos de NMR em todo o mundo. Para a maioria das proteínas, podemos produzir amostras marcadas com isótopos de grau HSQC. Juntamente com várias atribuições de mudança química de NMR disponibilizadas publicamente em covid19-nmr.com, aqui fornecemos recursos altamente valiosos para a produção de proteínas SARS-CoV-2 na forma marcada com isótopos.


MATERIAIS E MÉTODOS

Materiais

Os oligonucleotídeos e iniciadores aleatórios de DNA eram do DNA Core da Universidade de Michigan. Taq A DNA polimerase foi preparada conforme descrito (18). O polinucleotídeo quinase T4 foi obtido de New England Biolabs. Xbaeu e SalEu era da Boehringer Mannheim. O γ-32 P-ATP era da New England Nuclear e o α-32 P-ATP era da Amersham. A celulose foi adquirida de W & ampR Balston, Reino Unido. A celobiose era da Pfanstiehl Chemicals. Gentiobiose, lactose e maltose eram da Sigma. Celotriose, celotetraose e celopentaose foram adquiridas em Seikagaku, Tóquio.

Em vitro Seleção e amplificação.

Foi sintetizado um pool de oligômero de DNA de 86 nucleotídeos contendo 40 nucleotídeos centrais de sequência aleatória flanqueada por locais de ligação do primer definidos (Fig. 1). Isso resultou em um pool inicial com complexidade estimada de 10 14 –10 16 sequências diferentes: (5′-ATAGGAGTCGACCGACCAGAA [N]40 TATGTGCGTCTACATCTAGACTCAT).

Seleção de aptâmeros de DNA anticelulose. A seleção começou com uma biblioteca de 10 15 moléculas de DNA contendo sequências 5 ′ e 3 ′ conhecidas (para iniciação de PCR) e 40 posições de nucleotídeos centrais nas quais a sequência havia sido randomizada durante a síntese. Na primeira rodada, a biblioteca foi ligada à celulose, lavada extensivamente e eluída primeiro com o método A (competidor de celobiose 50 mM, EDTA 2,5 mM) e depois com o método B (50% de formamida). O DNA eluído da primeira rodada de ligação sob essas duas condições foi mantido separado nas 13 rodadas subsequentes de seleção de ligação e amplificação por PCR, eluindo apenas com o método original. Pools de aptâmeros de DNA da 14ª rodada de seleção por cada método foram convertidos em DNA de fita dupla, ligados em vetores de plasmídeo para produzir clones individuais. O DNA de mais de 200 clones foi reamplificado para produzir aptâmeros “monoclonais”, dos quais 80% se ligaram fortemente à celulose.

Os oligonucleotídeos de DNA curtos para amplificar as sequências selecionadas foram: iniciador 5 ', iniciador 5' -ATAGGAGTCGACCGACCAGAA 3 ', iniciador 5' -ATGAGTCTAGATGTAGACGCACATA.

O método de seleção é mostrado na Fig. 1. Para a seleção de primeira rodada, 1 mg de biblioteca de DNA foi passado por uma coluna de celulose de 50 mg 10 vezes. A coluna foi lavada com 4 × 400 μl de tampão de ligação (Tris 20 mM, pH 7,5 / NaCl 100 mM / MgCl 5 mM2) e sequencialmente eluída primeiro com o método de eluição A (celobiose 50 mM, EDTA 2,5 mM) e, em seguida, com o método B (formamida 50%). Os aptâmeros eluídos foram precipitados com etanol e ressuspensos em 50 μl de H2O. PCRs assimétricos foram usados ​​para amplificar as sequências de DNA recuperadas de 40 μl do eluato de DNA ressuspenso e recuperar o DNA de fita simples. O PCR assimétrico de 400 μl consistiu em: 1 × tampão de PCR (Tris 10 mM, pH 9,1 / KCl 50 mM / MgCl 0,5 mM2), 200 μM dNTPs, 18,5 μg 5′-primer, 0,64 μg 3′-primer e 2,5 unidades Taq DNA.O protocolo de ciclagem foi de 30 ciclos de: 94 ° C por 45 seg, 60 ° C por 1 min, 72 ° C por 2 min. Uma alíquota de 350 μl do produto de PCR foi ligada à próxima coluna de celulose empacotada de 50 μl e o processo de eluição / amplificação foi repetido 13 rodadas. Após a primeira rodada de eluição pelo método A, depois o método B, as rodadas 2 a 14 mantiveram o DNA selecionado pelos dois métodos separados.

Obtenção de aptâmeros monoclonais de piscinas selecionadas.

Fragmentos de DNA de fita dupla foram preparados a partir da rodada 14 do método A e pools do método B, clivados no terminal Xbaeu e SalLocal I, e ligado a esses locais no plasmídeo pUC19. Transformação em Escherichia coli a cepa DH5α foi seguida por triagem por PCR direta de colônias bacterianas contendo plasmídeo. A diferença entre o PCR de colônia e o PCR descrito acima foi que as amostras de células foram inicialmente desnaturadas a 94 ° C por 5–10 min, seguido por 30–35 ciclos usando igual quantidade de 5′-primer e 3′-primer (0,5 μg) para produzir DNA de fita dupla (dsDNA) correspondente a sequências únicas do pool selecionado. Os DNAs de aptâmero de fita simples individuais foram derivados de uma alíquota deste estoque de dsDNA por PCR assimétrica da amplificação de dsDNA.

Ensaio de ligação de celulose.

O α- 32 P-dATP foi incorporado ao DNA de fita simples usando PCR assimétrico e isolado após separação eletroforética em géis de poliacrilamida desnaturante a 10%. O DNA de cadeia simples marcado com 32P foi pré-incubado com tampão de ligação ou celobiose 50 mM (dissolvido em tampão de ligação) por 10 min em temperatura ambiente. Em seguida, 200 μl da mistura foram ligados a 12-15 mg de celulose com mistura suave por 20 min. A fração não ligada foi salva e a celulose foi lavada com 200 μl de tampão de ligação. O aptâmero ligado foi eluído com 200 μl de método de eluição A ou método B, dependendo das condições usadas na seleção desse aptâmero. Alíquotas de 7,5 μl das frações não ligadas, lavadas ou eluídas foram analisadas por eletroforese em gel de poliacrilamida desnaturante 10% e expostas a um filme de raios-x.

Sequenciamento de DNA.

Foram sequenciados trinta e sete clones de aptâmeros de ligação à celulose. Eles incluíram todos os clones onde a ligação foi inibida pela celobiose. O DNA de plasmídeo foi isolado usando o miniprep de plasmídeo Qiagen QIAprep-spin. A sequenciação de DNA foi realizada utilizando iniciadores que flanqueiam o local de inserção do plasmídeo e reagentes da United States Biochemicals.

Ensaio de hipocromicidade.

Para determinar quantitativamente as propriedades de ligação de três aptâmeros, quantidades de miligramas foram sintetizadas quimicamente. Apenas a região variável interna de três aptâmeros em foram usados: o 41 mer do Cel # 16, o 40 mer do Cel # 183 e o 36 mer do Cel # 202 (ver Tabela 1). Um oligonucleotídeo de controle 41-mer também foi usado para mostrar que os dissacarídeos geralmente não causavam hipercromia. A sequência do 41 mer foi degenerada 2 vezes em quatro posições: 5'-CCGAATTCTGGAA (C ou G) (A ou T) CCC (T ou A) (A ou C) GCTTTCCTGATGAGTCCGTGA. Para analisar a ligação dos DNAs aos dissacarídeos solúveis, a hipocromicidade foi medida a 260 nm como um reflexo da mudança conformacional na ligação do açúcar. Aptâmeros de DNA em concentrações entre 0,0006 e 0,0007 mM foram pré-incubados com açúcares de 0,00003 mM a 10 mM (celobiose, celotetraose, gentiobiose, lactose e maltose) à temperatura ambiente por 1 hora antes de ler a absorbância a 260 nm. Concentrações mais altas de vários açúcares levaram a quedas aberrantemente grandes na absorbância, provavelmente causadas por agregação, e concentrações maiores que 1 mM não foram incluídas nas interpretações. A celotriose e a celopentaose (não mostradas) forneceram dados semelhantes aos da celotetraose. As leituras foram feitas em triplicata, corrigindo a menor absorvância pelos açúcares, e cada experimento foi repetido três ou mais vezes. A hipocromicidade é representada como a% de alteração na absorvância sem adição de açúcar (ver Fig. 3), os erros nas leituras em triplicado de um experimento são representados por barras.

Sequências de aptâmeros de DNA de ligação de celulose


Discussão

Nosso modelo de trabalho atual para a ativação da clivagem do DNA por SgrAI envolve a montagem de complexos SgrAI / DNA em um oligômero run-on que estabiliza uma conformação ativada da enzima SgrAI [10]. Esta conformação ativada tem uma taxa acelerada de clivagem de DNA de ambas as sequências do local primário e secundário em comparação com a forma dimérica de baixa atividade de SgrAI. O oligômero é um oligômero "run-on" devido à sua capacidade de adicionar complexos SgrAI / DNA adicionais em uma ou ambas as extremidades do oligômero (uma hélice esquerda) de uma maneira potencialmente interminável (Fig 3A). O modelo prevê que a formação do oligômero run-on é favorecida apenas quando SgrAI está ligado à sua sequência de reconhecimento primária, mas também que o oligômero run-on é capaz de incorporar, e assim ativar, SgrAI ligado a sequências de locais secundários. Este modelo para ativação SgrAI foi derivado de vários estudos anteriores de clivagem de DNA por SgrAI [5,6,24], bem como estudos estruturais incluindo estruturas de alta resolução da forma de baixa atividade [8,11,12] e um 8,6 Å estrutura crio-EM da forma ativada (o oligômero run-on) [10]. Aqui, procuramos testar as predicações feitas com base no modelo crio-EM usando mutagênese dirigida ao local, bem como expandir nossa compreensão de vários outros aspectos da ativação de SgrAI (ver abaixo).

Nosso ensaio padrão para investigar a ativação de SgrAI utiliza uma baixa concentração de DNA repórter contendo o local de reconhecimento SgrAI (marcado com 32 P), altas concentrações da enzima SgrAI e concentrações variadas de DNA ativador não marcado. Normalmente, o DNA ativador é uma versão clivada da sequência do sítio primário (isto é, DNA do PC, Fig. 1), no entanto, também testamos outras versões do sítio primário, incluindo a sequência do sítio primário intacta (40-1, Fig. 1) e um versão não clivável da sequência do local primário intacta (22-1-3'S, Fig. 1), bem como uma sequência do local secundário (40-2A, Fig. 1). As condições de clivagem de DNA de renovação única (ou seja, o grande excesso de concentração de SgrAI sobre a concentração de DNA repórter) permite a medição de uma constante de taxa de primeira ordem para clivagem de DNA (kobs, Tabela 1). Descobrimos que esta constante de taxa varia com a concentração de DNA ativador (“DNA ativador não rotulado adicionado”, Tabela 1), tornando-se mais rápida com concentrações mais altas de DNA ativador (consulte “Aceleração relativa”, Tabela 1). Anteriormente, discutimos nossa interpretação desse fenômeno, ou seja, na captura parcial ou total da taxa de formação de oligômero em execução (que dependeria da concentração de SgrAI ligado ao DNA do ativador) no kobs [5]. No estudo atual, preenchemos vários aspectos ausentes do modelo de ativação SgrAI. Primeiro, descobrimos que o uso de uma molécula de DNA repórter com um maior número de pares de bases flanqueando o local de reconhecimento SgrAI (ou seja, 40-1 vs. 18-1, Fig. 1) aumenta a aceleração relativa da clivagem de DNA em concentrações intermediárias de ativador DNA (compare com DNA de PC 100 nM, Tabela 1, Fig 2). Anteriormente, mostramos que o DNA de flanco era importante no ativador DNA, onde um maior número de pares de bases flanqueadoras resulta em um maior grau de ativação de SgrAI [10]. Em ambos os casos, considerando o repórter ou o DNA ativador, esses resultados são facilmente explicados por nosso modelo da forma ativada de SgrAI no modelo crio-EM do oligômero run-on, os resíduos de um complexo SgrAI / DNA parecem próximos o suficiente para fazer interações iônicas, de ligação de hidrogênio e / ou van der Waals com o DNA flanqueador (magenta, Fig. 3A) do complexo SgrAI / DNA vizinho (Fig. 3A e 3F). Nas reações de clivagem de DNA, o oligômero run-on seria composto em grande parte por SgrAI ligado ao DNA de PC estabilizado por interações entre o DNA flanqueador de um complexo de SgrAI / PC DNA para resíduos de SgrAI do complexo vizinho de SgrAI / PC DNA (bem como por interações proteína-proteína entre SgrAI vizinhos). Da mesma forma, o SgrAI ligado ao DNA repórter (ou seja, 18-1 ou 40-1) seria ativado sendo assimilado neste oligômero de execução e fazendo os mesmos tipos de interações. O DNA flanqueador destacado em magenta (Fig. 3A, e rosa e magenta, Fig. 3F) estão presentes em 40-1, mas não 18-1. Portanto, seria esperado que SgrAI ligado a 40-1 se ligasse com uma afinidade maior ao oligômero run-on e, portanto, fosse ativado em concentrações mais baixas do oligômero run-on.

Da mesma forma, as medições com um local secundário contendo mais pares de bases flanqueadoras (40-2A vs. 18-2, Fig. 1) resultam em graus consideravelmente maiores de ativação (até 7000 vezes em Aceleração Relativa, Tabela 1) (compare 40-2A e 18–2, Fig. 2), no entanto, as constantes de taxa medidas para a clivagem de DNA do sítio secundário na concentração mais alta de DNA ativador testado ainda ficam aquém das medidas para a clivagem do sítio primário (compare 40-2A e 40-2B com 40-1 e 18-1 em DNA de PC de 1000 nM, Fig. 2). A dependência da constante de taxa de clivagem de DNA na concentração de DNA ativador também difere entre o local secundário (40-2A e 40-2B, Fig. 2) e o local primário com o mesmo número de pares de bases flanqueadoras (40-1, Fig 2), exigindo mais DNA ativador para atingir níveis semelhantes de ativação para a clivagem do sítio secundário (Fig 2). Isso não pode ser simplesmente explicado por uma menor afinidade de SgrAI para o local secundário, uma vez que as afinidades medidas foram encontradas na faixa de 10-30 nM (nota: estes foram medidos na presença de Ca 2+, mas medições com o cataliticamente relevante Mg 2+ indica apenas um K 5-6 vezes mais fracoD, Mesa 2). Em vez disso, interpretamos este resultado como uma afinidade reduzida do oligômero run-on para o complexo contendo SgrAI ligado ao local secundário. Isso é consistente com nosso modelo para a incapacidade do DNA do sítio secundário para ativar SgrAI, ou seja, que a ligação ao sítio secundário por SgrAI favorece a conformação de baixa atividade que teria uma afinidade mais baixa para o oligômero run-on, uma vez que o oligômero run-on preferencialmente liga (e assim estabiliza) a conformação ativada [10].

Os resultados com mutações únicas em SgrAI, projetadas para interromper o oligômero run-on sem interromper a estrutura de SgrAI ou a ligação ao DNA, também apóiam nosso modelo para ativação de SgrAI (Tabelas 3-5, Fig. 3). Essas substituições foram localizadas em qualquer uma das duas alças que fazem contato próximo com o DNA de flanco de um complexo SgrAI / DNA vizinho na estrutura de oligômero de execução (Fig. 3A e 3F), ou em um caso, distal de quaisquer contatos (E301W, Fig. 3A e Fig 3F). As substituições com maior efeito foram aquelas que introduzem uma carga negativa (S56E, A57E, Tabela 3) ou aquelas que removem uma carga positiva (R131A e R134A, Tabela 3), consistente com repulsão de carga ou, alternativamente, perda de atração de carga para o DNA. No entanto, essas substituições não afetaram significativamente a ligação de DNA por SgrAI (Tabela 4) ou a taxa basal de clivagem de DNA por SgrAI na ausência de DNA ativador (compare a concentração de 0 nM de DNA de PC, Tabela 3, com a de SgrAI de tipo selvagem com 18–1 marcado com 32 P, Tabela 1), indicando interrupção mínima da forma de baixa atividade (ou seja, o SgrAI ligado ao DNA dimérico). Os resultados são, portanto, consistentes com a perturbação das interações entre o DNA de flanco (magenta, Fig 3A, rosa e magenta, Fig 3F) e SgrAI vizinho no oligômero run-on. Em contraste, o SgrAI substituído com E301W se comportou como tipo selvagem nos ensaios de clivagem de DNA (Tabela 5), ​​consistente com a posição de E301 distal de quaisquer interfaces no complexo SgrAI / DNA ou no oligômero run-on (Fig 3). Finalmente, a última peça que apresentamos aqui apoiando nosso modelo de oligômero run-on de SgrAI deriva de duas investigações estruturais independentes anteriores, uma usando espectrometria de massa (espectrometria de massa de mobilidade iônica [9]) e a outra o estudo estrutural crio-EM [10] , que fornecem medidas consistentes do tamanho do oligômero run-on contendo 1–6 cópias do dímero SgrAI ligado ao DNA (DBD) (S4 Fig).

Além dos estudos que sondam o modelo estrutural do oligômero run-on descrito acima, apresentamos os resultados de vários novos estudos que sondam os parâmetros de ativação de SgrAI. Primeiro, testamos se o sítio primário não clivado poderia ativar SgrAI na mesma extensão que o clivado. Comparando 1 μM 40-1 a 2 μM PC DNA (uma vez que cada dímero SgrAI se liga a um 40-1 ou dois PC DNA [9]), descobrimos que o PC DNA parece ativar SgrAI para duas vezes o valor da constante de taxa observada (usando 40–1 como o DNA repórter, Tabela 1). Uma vez que o DNA não clivado poderia, em princípio, ser clivado por SgrAI nesses ensaios, também testamos as propriedades de ativação alostérica de uma versão não clivável do sítio primário (22-1-3'S, Fig. 1), e descobrimos que é capaz de ativar SgrAI por 16 vezes (Tabela 1). Portanto, o sítio primário não clivado é de fato capaz de ativar SgrAI, no entanto, a versão clivada pode realmente fornecer uma ativação mais robusta.

Em relação aos dois tipos de sítio secundário SgrAI, aqueles com a substituição na 2ª / 7ª posição do nucleotídeo (ou seja, CRCCGG GG) e aqueles com a substituição na 1ª / 8ª posição (ou seja, CRCCGGY (A / C / T) ) (a sequência do local primário é CRCCGGYG), encontramos diferenças qualitativas e quantitativas na clivagem por SgrAI (40-2A é do primeiro tipo, 40-2B é do segundo tipo, Figs 1–2, Tabela 1). Primeiro, a clivagem do primeiro tipo requer concentrações mais baixas de DNA ativador para acelerar sua clivagem por SgrAI (Fig. 2). Em segundo lugar, na ausência de ativação, a clivagem do segundo tipo (40-2B, Tabela 1) é muito mais lenta em uma fita do que na outra (mais lenta na fita inferior, Tabela 1). Isso pode ser porque nesta fita o local de clivagem está mais próximo da substituição na sequência (a diferença na sequência em comparação com a sequência do local primário, Fig. 1), portanto, potencialmente resultando em maior ruptura estrutural do local ativo de clivagem, um fenômeno vimos antes com uma endonuclease de restrição diferente [25,26]. É interessante que as diferenças nas taxas de clivagem das duas fitas desaparecem com maiores concentrações de DNA ativador (Tabela 1). Isso sugere que uma assimetria na conformação de baixa atividade está ausente na conformação ativada. O mecanismo para esta mudança aguarda as estruturas de alta resolução de SgrAI (formas ativadas e de baixa atividade) ligadas a este tipo de DNA de sítio secundário. Até o momento, todas as estruturas de SgrAI ligadas ao sítio secundário foram com o primeiro tipo, e na baixa atividade conformação [12], e os detalhes atômicos da estrutura do estado ativado de SgrAI é limitado pelo estudo crio-EM de resolução (8.6 A) e é com o sítio primário de DNA [10].

Finalmente, investigamos o potencial de clivagem ativada de uma sequência não reconhecida, que difere da primária em dois pares de bases, e é essencialmente uma versão simetrizada de um sítio secundário (isto é, C T CCGG A G, 40-NCTA, Fig. 1). Descobrimos que SgrAI clivou apenas uma pequena porcentagem deste DNA, e com k muito lentoobs (Tabela 1). Ao contrário do DNA de sítio secundário, o DNA ativador não foi capaz de ativar SgrAI para clivar essa sequência (Tabela 1). A falta de clivagem não foi devido à falta de ligação a esta sequência, uma vez que a afinidade para o DNA foi medida como estando na faixa nanomolar baixa, com Ca 2+ ou Mg 2+ (Tabela 2). Este resultado sugere que a capacidade de SgrAI para clivar sequências de locais secundários não é meramente perda de reconhecimento para os dois pares de bases externos, caso contrário, o 40-NCTA também deve ser clivado por SgrAI. Sugerimos que a ligação ao DNA não reconhecido pode resultar no bloqueio de SgrAI de atingir a conformação ativada e, portanto, de se ligar ao oligômero contínuo.

O mecanismo incomum de ativação e modulação da especificidade do substrato exibido por SgrAI pode realmente ser compartilhado em maior ou menor grau por uma lista crescente de enzimas. A formação de filamentos contínuos que afeta a atividade enzimática foi demonstrada por um punhado de outras enzimas, incluindo IRE1 [2] (uma quinase / RNase envolvida na resposta da proteína desdobrada), acetil-CoA carboxilase [3] (ACC), CTP sintase [4,27,28] (CTPS) e cinases RIP1 / RIP3 [29] (envolvidas na necrose programada). O crescente corpo de conhecimento sobre os mecanismos dessas enzimas permite uma comparação de detalhes mecanísticos com os de SgrAI. Primeiro, SgrAI é ativado de um estado de baixa atividade para um que é 200-1000 vezes mais ativo no oligômero de run-on IRE1, ACC e RIP1 / RIP3 também são ativados em suas formas oligoméricas / filamentosas, enquanto CTPS é inibido. O grau real de ativação pode variar naqueles ativados por oligomerização, sendo 200-1000 vezes para SgrAI, 60 vezes para ACC [3] e mais de 100.000 vezes no caso da atividade RNase de IRE1 [2] (para RIP1 / RIP3 não foi quantificado). A formação de filamentos é estimulada pela ligação do substrato apenas no caso de SgrAI, enquanto IRE1, ACC, RIP1 / RIP3 e CTPS formam filamentos em resposta à ligação a ativadores (proteínas não dobradas no caso de IRE1, e o citrato efetor alostérico no caso de ACC), produtos (CTP, que é o produto da CTPS) ou fosforilação (RIP1 / RIP3). A fosforilação também parece estar envolvida na oligomerização adicional de IRE1, uma vez que a oligomerização inicial tenha começado [2,7]. Além disso, os substratos da CTPS podem induzir sua despolimerização para produzir a forma ativa da enzima [27]. A modulação da especificidade do substrato após oligomerização contínua ou formação de filamento também ocorre no sistema SgrAI. Apenas IRE1 parece apresentar uma propriedade semelhante, pois cliva outras moléculas de RNA, além de seu mRNA alvo, quando em seus filamentos mais longos [7]. Algumas características aparentemente únicas no sistema SgrAI incluem o fato de que ele se liga fortemente a ambos os tipos de locais, primário e secundário, em sua forma de baixa atividade, mas apenas cliva primário nesse estado (o DNA do local secundário é clivado significativamente por SgrAI apenas na execução -em oligômero). Além disso, tanto o substrato (primário não clivado) quanto o produto (DNA primário clivado) estabilizam a forma oligomérica contínua de SgrAI. Outra característica que diferencia esses sistemas é o potencial para uma rápida associação e cinética de dissociação, que são prováveis ​​em todos os casos, exceto no sistema RIP1 / RIP3, que parece formar uma amiloide irreversível [29]. Finalmente, o papel biológico proposto para a formação de oligômero / filamento run-on inclui ativação rápida (ou desativação no caso de CTPS) em todos os casos e ligação aumentada de substrato (através de uma interface maior no caso de IRE1 e também possivelmente RIP1 / RIP3 ) No caso da CTPS, o filamento foi proposto para ser um mecanismo adicional de ajuste fino da função da enzima para as concentrações ambientais de substrato e produto, criando um pool prontamente ativável de enzimas inativas [27]. Apenas o oligômero run-on formado por SgrAI tem o papel proposto de sequestro de enzimas ativadas [5,10]. Postulamos que este mecanismo evoluiu devido ao genoma relativamente longo de Streptomyces griseus, do qual SgrAI deriva o genoma mais longo resultaria em um maior número potencial de locais de clivagem de DNA, que devem ser protegidos pela metiltransferase cognata para evitar danos ao DNA do hospedeiro pela endonuclease SgrAI. Se a atividade da metiltransferase for limitada, talvez devido à disponibilidade do cofator, o sistema poderia responder evolutivamente reduzindo a atividade da endonuclease. A sequência de reconhecimento incomumente longa de SgrAI (8 bp vs. 4-6 bp) e a baixa atividade de clivagem de DNA na ausência de ativação reduzem a atividade de SgrAI, mas também diminuem simultaneamente a eficácia da enzima contra o DNA do fago invasor. No entanto, a capacidade de SgrAI para ativar sua atividade de clivagem mais de 200 vezes, e também expandir sua especificidade de sequência (de 3 para 17 sequências diferentes) na presença de sítios primários não metilados (por exemplo, como esperado no DNA do fago) recupera sua atividade contra fago. A formação de oligômero run-on pode ter evoluído para sequestrar SgrAI ativado no fago e longe do DNA do hospedeiro, uma vez que a clivagem em locais secundários presumivelmente não metilados no DNA do hospedeiro seria prejudicial ao hospedeiro. Além disso, o oligômero run-on também pode servir para ativar rapidamente muitos SgrAI por assimilação de um número potencialmente ilimitado de SgrAI ligado ao DNA em um oligômero em crescimento e / ou para bloquear a replicação e a transcrição do DNA do fago. Em conclusão, SgrAI parece ser um membro de um pequeno (mas talvez crescente [30-34]) grupo de enzimas conhecido por ser modulado pela formação de oligômeros ou filamentos contínuos. No entanto, o SgrAI também mantém várias características exclusivas. Mais trabalho será necessário para determinar o quão generalizáveis ​​os mecanismos de SgrAI e as outras enzimas com comportamento semelhante são na natureza.


Cálculo de concentrações para PCR

i) Os iniciadores de oligonucleotídeo são geralmente fornecidos como "tantas unidades OD / ml" - mas o que faz isso quer dizer, em termos de mg / ml, ou mmol / ml, etc?

Dado: um primer tem nucleotídeos Y (nt) de comprimento

Dado: o MW de ssDNA é (330 daltons por nt) x (comprimento em nt) (Sambrook et al., 1989 p. C.1)

Dado: a concentração do primer (= ssDNA) produzindo uma DO de 1 a 254 nm em uma cubeta de 1 cm, é 37 ug / ml

Então: o MW do primer é 330.Y daltons

E: X OD / ml = 37.X ug / ml = 37.X mg / l = 37.X /330.Y mM = 37.X.1000 / 330.Y uM

Por exemplo:

O iniciador B 88/77 - um oligodesoxinucleotídeo 17-mer - fornecido é de 12,6 unidades OD / ml. Precisamos fazer uma solução estoque de 5 uM para PCR.

MW: 17 x 330 = 5610

Concentração: 12,6 OD x 37 ug / ml = 466 ug / ml = 466 mg / l = 0,466 g / l

Molaridade: 0,466 / 5610 = 0,000083 Molar = 83 uM

Portanto: precisamos de 5 ul de solução estoque de oligo em 83 ul (+78 ul de água) para fazer uma solução 5 uM (se 1 ul em 83 ul der uma solução de 1 uM)

ii) Cálculo de quantidades para reações de PCR: se precisarmos de uma concentração final de 0,5 uM de oligo na mistura de reação de PCR (volume final 50 ul), adicionamos 5 ul de estoque 5 uM à mistura de reação (diluição final 1/10) .

B) Nucleotídeos:

Os estoques de nucleotídeos para PCR (ou outro procedimento) são QUASE SEMPRE dNTP s (desoxinucleotídeos), e as concentrações quase sempre são dadas em CADA dNTP: ou seja, a concentração dada é CADA nucleotídeo na mistura, NÃO a concentração total. Isso significa que uma mistura de dNTP 2,5 mM para PCR contém 2,5 mM de CADA dNTP e dNTPs TOTAL 10 mM.

Exemplo:

i) Faça uma solução estoque 2,5 mM de dNTPs a partir de dNTPs individuais estoque 100 mM, fornecidos pela Promega:

  • PRIMEIRO misture volumes iguais de cada nucleotídeo (por exemplo: 50 ul): isso dá a você 200 ul de dNTPs mistos de 25 mM (Lembre-se: concn. expresso em CADA dNTP).
  • ENTÃO diluir este (ou alíquota) 1/10 com AGUA - alíquota em quantidades de 100 ul e congelar.

ii) Prepare um estoque de 1 mM de dNTPs com dTTP substituído a 10% (p / p) por digoxigenina-11-dUTP (DIG-dUTP) para uso como uma mistura de rotulagem para rotulagem de PCR de produtos de PCR:

  • DIG-dUTP fornecido (pela Boehringer Mannheim) a 25 nmol / 25ul = 1 umol / ml = 1 mM concentração final de DIG-dUTP deve ser 1/10 da de outros nucleotídeos, e [DIG-dUTP] + [dTTP] deve = [ qualquer outro dNTP]. Portanto, para obter um estoque dNTP de 1 mM, deve-se diluir o estoque DIG-dUTP 1/10.
  • PRIMEIRO diluir estoques de dNTP 100 mM separados para 10 mM (por exemplo, 5 ul a 50 ul, em água).
  • ENTÃO misture volumes iguais (por exemplo, 10 ul) de estoque de dCTP, dGTP e dATP 10 mM e volume de 9/10 de dTTP (9 ul). Adicione um volume igual (por exemplo, 10 ul) de 1 mM DIG-dUTP.
  • ENTÃO adicionar água a 10 vol (= 100 ul adicionar 51 ul): concentração final de cada dNTP = 1 mM concn final DIG-dUTP = 0,1 mM, e de dTTP = 0,9 mM.

iii) USE a mistura feita acima a 50 uM cada dNTP em uma mistura de reação de PCR, volume final 25ul:


Como posso produzir quantidades em miligramas de um oligômero de DNA marcado com isótopo? - Biologia

Esta é uma divisão da aplicação Ser. No. 08 / 383.766 depositado em 2 de fevereiro de 1995, que é uma continuação em parte do pedido de ser. Nº 08 / 180.863 depositado em 13 de janeiro de 1994, agora abandonado, que é uma continuação em parte do pedido de Ser. No. 08 / 092.863 protocolado em 16 de julho de 1993, agora abandonado.

1. Um substrato pré-codificado útil para ser ligado a uma única estrutura de oligômero em que o referido substrato pré-codificado carrega um identificador único, a referida etiqueta sendo um microchip pré-codificado que identifica a referida estrutura de oligômero.

2. Um substrato codificável útil para ser ligado a uma única estrutura de oligômero em que o referido substrato codificável tem um identificador único, a referida etiqueta sendo um microchip codificável que identifica a referida estrutura de oligômero.

3. Um ou uma pluralidade do substrato pré-codificado, de acordo com a reivindicação 1, útil para um método de preparação de uma biblioteca de oligômero sintético marcado compreendendo uma pluralidade de membros diferentes, cada membro compreendendo um substrato pré-codificado distinto pelo qual o referido um ou a pluralidade de -substrato codificado está ligado a uma estrutura de oligômero, o referido método compreendendo as etapas de:

a) distribuir os referidos substratos pré-codificados entre uma pluralidade de vasos de reação

b) expor os referidos substratos pré-codificados em cada recipiente de reação a um ou uma pluralidade de eventos de transformação

c) detectar e registrar informações de identificador para cada uma das referidas etiquetas identificadoras em cada um dos referidos vasos de reação

d) distribuir os referidos substratos pré-codificados entre uma pluralidade de vasos de reação e

e) repetir as etapas a) a c) de pelo menos uma a cerca de vinte vezes, em que o referido substrato pré-codificado é um microchip pré-codificado.

4. Um ou uma pluralidade do substrato codificável, de acordo com a reivindicação 2, útil em um método de preparação de uma biblioteca de oligômero sintético marcado compreendendo uma pluralidade de membros diferentes, cada membro compreendendo um substrato codificável distinto pelo qual o referido um ou a pluralidade de substrato pré-codificado é um oligômero estrutura está ligada a uma estrutura de oligômero, o referido método compreendendo as etapas de:

a) distribuir os referidos substratos codificáveis ​​entre uma pluralidade de vasos de reação

b) expor os referidos substratos codificáveis ​​em cada recipiente de reação a um ou uma pluralidade de eventos de transformação

c) adicionar a primeira informação de identificador aos referidos substratos codificáveis

d) distribuir os referidos substratos codificáveis ​​entre uma pluralidade de vasos de reação e

e) repetir as etapas a) a c) de pelo menos uma a cerca de vinte vezes, em que o referido substrato codificável é um microchip codificável.

5. Um ou uma pluralidade do substrato pré-codificado, de acordo com a reivindicação 1, útil em um método de preparação de uma biblioteca de oligômero sintético marcado compreendendo uma pluralidade de membros diferentes, cada membro compreendendo um substrato pré-codificado distinto pelo qual o referido um ou a pluralidade de substrato codificado está ligado a uma estrutura de oligômero, o referido método compreendendo as etapas de:

a) distribuir os referidos substratos pré-codificados entre uma pluralidade de vasos de reação

b) expor os referidos substratos pré-codificados em cada recipiente de reação a um ou uma pluralidade de monômeros

c) detectar e registrar informações de identificador para cada uma das referidas etiquetas identificadoras em cada um dos referidos vasos de reação

d) distribuir os referidos substratos pré-codificados entre uma pluralidade de vasos de reação e

e) repetir as etapas a) a c) de pelo menos uma a cerca de vinte vezes, em que o referido substrato pré-codificado é um microchip pré-codificado.

6. Um ou uma pluralidade do substrato codificável, de acordo com a reivindicação 2, útil em um método de preparação de uma biblioteca de oligômero sintético rotulado compreendendo uma pluralidade de membros diferentes, cada membro compreendendo um substrato codificável distinto pelo qual o referido um ou a pluralidade de substrato pré-codificado é um oligômero estrutura está ligada a uma estrutura de oligômero, o referido método compreendendo as etapas de:

a) distribuir os referidos substratos codificáveis ​​entre uma pluralidade de vasos de reação

b) expor os referidos substratos codificáveis ​​em cada recipiente de reação a um ou uma pluralidade de monômeros

c) adicionar a primeira informação de identificador aos referidos substratos codificáveis

d) distribuir os referidos substratos codificáveis ​​entre uma pluralidade de vasos de reação e

e) repetir as etapas a) a c) de pelo menos uma a cerca de vinte vezes, em que o referido substrato codificável é um microchip codificável.

REFERÊNCIA CRUZADA PARA APLICATIVOS RELACIONADOS

ANTECEDENTES DA INVENÇÃO

BREVE DESCRIÇÃO DAS FIGURAS

DESCRIÇÃO DETALHADA DA INVENÇÃO

I. Bibliotecas de oligômeros rotulados

II. Métodos para gerar bibliotecas de oligômeros rotulados

III. Identificando a sequência de qualquer oligômero

4. Tipos de etiquetas identificadoras

V. Vinculando os oligômeros às tags identificadoras

VI. Codificando as informações da etiqueta identificadora

VII. Recuperando e decodificando as informações da etiqueta identificadora

VIII. Seleção de receptores com bibliotecas de oligômeros sintéticos marcados

EXEMPLO I. SÍNTESE DE CEM AMIDAS

EXEMPLO II. SÍNTESE EM ELAMS ™ DE QUATRO PENTAPEPTÍDEOS

A. Derivatização de ELAMS ™

B. Preparação de Boc-Gly-L-Phe-L-Leu-OH

C. Preparação de Gly-L-Phe-L-Leu ELAMS ™

D. Preparação de Gly-Gly-L-Phe-L-Leu (SEQ ID NO: 5) ELAMS ™

E. Preparação de L-Pro-Gly-L-Phe-L-Leu (SEQ ID NO: 6) ELAMS ™

F. Preparação de Tyr-Gly-Gly-L-Phe-L-Leu (SEQ ID NO: 1) e Tyr-Pro-Gly-L-Phe-L-Leu (SEQ ID NO: 2) ELAMS ™

G. Preparação de Pro-L-Pro-Gly-L-Phe-L-Leu (SEQ ID NO: 3) e Pro-Gly-Gly-L-Phe-L-Leu (SEQ ID NO: 4) ELAMS ™

H. Seleção de ligantes peptídicos contendo ELAMS ™ para o anticorpo monoclonal 3E7

EXEMPLO III. SÍNTESE PARALELA DE PEPTÍDEOS EM ELAMS ™

A. Derivatizando Amino ELAMS ™ com um Ligante

B. Síntese Paralela de Peptídeos

EXEMPLO IV. SÍNTESE PARALELA DE OCTAMERS OLIGONUCLEOTÍDEOS

A. Preparação de Hydroxyl ELAMS ™

C. Anexo do Linker de Síntese

D. Preparação da Sonda Fluoresceinilada

E. Síntese Paralela de Octanucleotídeos

EXEMPLO V. HIBRIDIZAÇÃO DE ALVO ESPECÍFICO DE SEQUÊNCIA

A presente invenção refere-se a bibliotecas de síntese combinatória marcadas e métodos e aparelhos para rotular membros individuais da biblioteca de uma biblioteca de síntese combinatória com etiquetas de identificação únicas que facilitam a elucidação das estruturas dos membros individuais da biblioteca sintetizados.

ANTECEDENTES DA INVENÇÃO

A relação entre estrutura e função das moléculas é uma questão fundamental no estudo dos sistemas biológicos. As relações estrutura-função são importantes para compreender, por exemplo, a função das enzimas, a comunicação celular e o controle celular e os mecanismos de feedback. Certas macromoléculas são conhecidas por interagir e se ligar a outras moléculas com uma distribuição espacial e eletrônica tridimensional específica. Qualquer macromolécula com tal especificidade pode ser considerada um receptor, seja a macromolécula uma enzima, uma proteína, uma glicoproteína, um anticorpo, uma sequência de oligonucleotídeo de DNA, RNA ou semelhantes. As várias moléculas às quais os receptores se ligam são conhecidas como ligantes.

A descoberta de medicamentos farmacêuticos é um tipo de pesquisa que se baseia no estudo das relações estrutura-função.

A maioria das descobertas contemporâneas de drogas envolve a descoberta de novos ligantes com padrões desejáveis ​​de especificidade para receptores biologicamente importantes. Assim, o tempo necessário para trazer novos medicamentos ao mercado poderia ser muito reduzido pela descoberta de novos métodos que permitem a triagem rápida de um grande número de ligantes potenciais.

Desde a introdução de métodos de síntese de fase sólida para peptídeos e polinucleotídeos, novos métodos empregando estratégias de fase sólida têm sido desenvolvidos e são capazes de gerar milhares, e em alguns casos até milhões, de peptídeos individuais ou polímeros de ácido nucleico usando técnicas automatizadas ou manuais. Estas estratégias de síntese, que geram famílias ou bibliotecas de compostos, são geralmente referidas como estratégias de "química combinatória" ou "síntese combinatória".

Estratégias de química combinatória podem ser uma ferramenta poderosa para elucidar rapidamente novos ligantes para receptores de interesse. Esses métodos mostram uma promessa particular para a identificação de novas terapêuticas. Ver genericamente, Gorgon et al., "Applications of Combinatorial Technologies to Drug Discovery: II. Combinatorial organic Synthesis, Library Screening Strategies, and Future Directions," J. Med. Chem. Chem 37: 1385-401 (1994) e Gallop et al., "Applications of Combinatorial Technologies to Drug Discovery: I. Background and Peptide Combinatorial Libraries", J. Med. Chem. Chem 37: 1233-51 (1994). Por exemplo, bibliotecas combinatórias foram usadas para identificar aptâmeros de ácido nucleico, Latham et al., "The Application of a Modified Nucleotide in Aptamer Selection: Novel Thrombin Aptamers Containing 5- (1-Pentynyl) -2'-Deoxy Uridine," Nucl . Acids Res. 22: 2817-2822 (1994) para identificar ligantes de RNA para a transcriptase reversa, Chen & Gold, "Selection of High-Affinity RNA Ligands to Reverse Transcriptase: Inhibition of cDNA Synthesis and RNase H Activity", Biochemistry 33: 8746-56 (1994 ) e para identificar anticorpos catalíticos específicos para um estado de transição de reação particular, Posner et al., "Catalytic Antibodies: Perusing Combinatorial Libraries," Trends. Biochem. Sci. 19: 145-50 (1994).

A diversidade de bibliotecas geradas usando estratégias combinatórias é impressionante. Por exemplo, esses métodos foram usados ​​para gerar uma biblioteca contendo quatro trilhões de decapeptídeos, Pinilla et al., "Investigation of Antigen-Antibody Interactions Using a Soluble, Non-Support-Bound Synthetic Decapeptide Library Composed of Four Trillion (4 × 10 12) Sequences, "Biochem. J. 301: 847-53 (1994) bibliotecas de 1,4-benzodiazepinas, Bunin et al., "The Combinatorial Synthesis and Chemical and Biological Evaluation of a 1,4-Benzodiazepine Library", Proc. Natl. Acad. Sci. 91: 4708-12 (1994) e U.S. Pat. No. 5.288.514, intitulada "Solid Phase and Combinatorial Synthesis of Benzodiazepine Compounds on a Solid Support", emitida em 22 de fevereiro de 1994, com bibliotecas contendo vários pequenos ligantes ligados nas mesmas moléculas, Wallace et al., "A Multimeric Synthetic Peptide Combinatorial Library , "Pept. Res. 7: 27-31 (1994) bibliotecas de pequenos orgânicos, Chen et al., "` Analogous` Organic Synthesis of Compound Libraries: Validation of Combinatorial Chemistry in Small-Molecule Synthesis, "J. Am. Chem. Soc. 116: 2661-2662 (1994) bibliotecas de receptores peptidosteroidais, Boyce & Nestler, "Peptidosteroidal Receptors for Opioid Peptides: Sequence-Selective Binding Using a Synthetic Receptor Library", J. Am. Chem. Soc. 116: 7955-7956 (1994) e bibliotecas de peptídeos contendo aminoácidos não naturais, Kerr et al., "Encoded Combinatorial Peptide Libraries Containing Non-Natural Amino Acids", J. Am. Chem. Soc. 115: 2529-31 (1993).

Até o momento, surgiram três estratégias gerais para gerar bibliotecas combinatórias: "endereçáveis ​​espacialmente", "split-bead" e estratégias recombinantes. Esses métodos diferem em um ou mais dos seguintes aspectos: projeto do vaso de reação, tipo e composição do polímero, controle de constantes físicas como tempo, temperatura e atmosfera, isolamento de produtos, métodos de ensaio em fase sólida ou em fase de solução, simples ou misturas complexas e método para elucidar a estrutura dos membros individuais da biblioteca.

Destas estratégias gerais, várias subestratégias foram desenvolvidas. Uma estratégia espacialmente endereçável que surgiu envolve a geração de bibliotecas de peptídeos em pinos imobilizados que se ajustam às dimensões de placas de microtitulação padrão. Ver Publicações PCT Nos. 91/17271 e 91/19818, cada uma das quais é aqui incorporada por referência. Este método foi usado para identificar péptidos que mimetizam epítopos descontínuos, Geysen et al., BioMed. Chem. Lett. 3: 391-404 (1993), e para gerar bibliotecas de benzodiazepinas, Pat. No. 5.288.514, intitulada "Solid Phase and Combinatorial Synthesis of Benzodiazepine Compounds on a Solid Support", emitida em 22 de fevereiro de 1994 e Bunin et al., "The Combinatorial Synthesis and Chemical and Biological Evaluation of a 1,4-Benzodiazepine Library, "Proc. Natl. Acad. Sci. 91: 4708-12 (1994). As estruturas dos membros individuais da biblioteca podem ser decodificadas analisando a localização do pino em conjunto com a sequência de etapas de reação usadas durante a síntese.

Uma segunda estratégia endereçável espacialmente relacionada que emergiu envolve a síntese em fase sólida de polímeros em vasos de reação individuais, onde os vasos individuais são organizados em uma única unidade de reação. Um exemplo ilustrativo de tal unidade de reação é uma placa de microtitulação de 96 poços padrão, a placa inteira compreende a unidade de reação e cada poço corresponde a um único recipiente de reação. Esta abordagem é uma extrapolação da síntese tradicional em fase sólida de coluna única.

Como é exemplificado pela unidade de reação de placa de 96 poços, cada recipiente de reação é espacialmente definido por uma matriz bidimensional. Assim, as estruturas de membros individuais da biblioteca podem ser decodificadas analisando a sequência de reações a que cada poço foi submetido.

Outra estratégia endereçável espacialmente emprega "saquinhos de chá" para conter a resina de síntese. É registrada a seqüência de reações a que cada saquinho de chá está sujeito, que determina a estrutura do oligômero sintetizado em cada saquinho de chá. Ver, por exemplo, Lam et al., "A New Type of Synthetic Peptide Library for Identifying Ligand-Binding Activity", Nature 354: 82-84 (1991) Houghten et al., "Generation and Use of Synthetic Peptide Combinatorial Libraries for Basic Research and Drug Discovery, "Nature 354: 84-86 (1991) Houghten," General Method for the Rapid Solid-Phase Synthesis of Large Numbers of Peptides: Specificity of Antigen-Antibody Interaction at the Level of Individual Amino Acids, "Proc. Natl. Acad. Sci. 82: 5131-5135 (1985) e Jung et al., Agnew. Chem. Int. Ed. Enal. 91: 367-383 (1992), cada um dos quais é aqui incorporado por referência.

Em outro desenvolvimento recente, os cientistas combinaram as técnicas de fotolitografia, química e biologia para criar grandes coleções de oligômeros e outros compostos na superfície de um substrato (este método é chamado de "VLSIPS ™"). Ver, por exemplo, Patente U.S. No. 5.143.854 Publicação PCT No. 90/15070 Publicação PCT No. 92/10092 intitulada "Very Large Scale Immobilized Polymer Synthesis", junho.25, 1992 Fodor et al., "Light-Directed Spatially Addressable Parallel Chemical Synthesis," Science 251: 767-773 (1991) Pease et al., "Light-Directed Oligonucleotide Arrays for Rapid DNA Sequence Analysis," Proc. Natl. Acad. Sci. 91: 5022-5026 (1994) e Jacobs & Fodor, "Combinatorial Chemistry: Applications of Light-Directed Chemical Synthesis," Trends. Biotechnology 12 (1): 19-26 (1994), cada um dos quais é aqui incorporado por referência.

Outros desenvolveram métodos recombinantes para preparar coleções de oligômeros. Ver, por exemplo, Publicação PCT No. 91/17271 Publicação PCT No. 91/19818 Scott, "Discovering Peptide Ligands Using Epitope Libraries", TIBS 17: 241-245 (1992) Cwirla et al., "Peptides on Phage: A Vast Library of Peptides for Identifying Ligands, "Proc. Natl. Acad. Sci. 87: 6378-6382 (1990) Devlin et al., "Random Peptide Libraries: A Source of Specific Protein Binding Molecules," Science 249: 404-406 (1990) and Scott & Smith, "Searching for Peptide Ligands with an Epitope Library , "Science 249: 386-390 (1990). Usando esses métodos, pode-se identificar cada oligômero na biblioteca determinando as sequências de codificação no organismo ou fago recombinante. No entanto, uma vez que os membros da biblioteca são gerados in vivo, os métodos recombinantes são limitados a polímeros cuja síntese é mediada na célula. Assim, esses métodos tipicamente têm se restringido à construção de bibliotecas de peptídeos.

Uma terceira estratégia geral que surgiu envolve o uso de estratégias de síntese combinatória "split-bead". Ver, por exemplo, Furka et al., Int. J. Pent. Protein Res. 37: 487-493 (1991), que é aqui incorporado por referência. Neste método, os suportes de síntese são distribuídos em alíquotas, cada alíquota exposta a um monômero e os grânulos agrupados. As contas são então misturadas, reatribuídas em alíquotas e expostas a um segundo monômero. O processo é repetido até que a biblioteca desejada seja gerada.

Uma vez que as bibliotecas de polímero geradas com o método split-bead não são espacialmente endereçáveis, as estruturas dos membros individuais da biblioteca não podem ser elucidadas pela análise do histograma de reação. Em vez disso, as estruturas devem ser determinadas analisando os polímeros diretamente. Assim, uma limitação da abordagem split-bead é o requisito de um meio disponível para analisar a composição do polímero. Embora as técnicas de sequenciação estejam disponíveis para peptídeos e ácidos nucleicos, as reações de sequenciamento para polímeros de outra composição, como, por exemplo, carboidratos, orgânicos, ácidos nucleicos de peptídeos ou polímeros mistos podem não ser facilmente conhecidas.

Surgiram variações no esquema de "divisão de contas" que evitam a necessidade de sequenciar o membro da biblioteca diretamente. Esses métodos utilizam produtos químicos para marcar os polímeros em crescimento com uma etiqueta de identificação exclusiva (estratégias de "co-síntese"). Ver, por exemplo, a Publicação PCT Nº WO 94/08051 intitulada "Complex Combinatorial Chemical Libraries Encoded with Tags", 14 de abril de 1994 Nestler et al., "A General Method for Molecular Tagging of Encoded Combinatorial Chemistry Libraries," J. Org. Chem. 59: 4723-4724 (1994) Publicação PCT Nº WO 93/06121 intitulada "Method of Synthesizing Diverse Collections of Oligomers", 1 de abril de 1993 Needels et al., Proc. Natl. Acad. Sci. 90: 10700-10704 (1993) Kerr et al., "Encoded Combinatorial Peptide Libraries Containing Non-Natural Amino Acids", J. Amer. Chem. Soc. 115: 2529-2531 (1993) e Brenner & Lerner, "Encoded Combinatorial Chemistry", Proc. Natl. Acad. Sci. 89: 5381-5383 (1992), cada um dos quais é aqui incorporado por referência.

A codificação de membros da biblioteca com marcas químicas ocorre de tal forma que identificadores únicos das estruturas químicas dos membros individuais da biblioteca são construídos em paralelo, ou são co-sintetizados, com os membros da biblioteca. Normalmente, em uma síntese linear de três componentes contendo os blocos de construção A, B e C no processo de geração do membro da biblioteca ABC, uma marca de codificação é introduzida em cada estágio de modo que as marcas TUMA, TB e TC codificaria para entradas individuais na biblioteca. A síntese ocorreria da seguinte forma: (a) o produto químico A é acoplado a uma esfera de síntese, imediatamente seguida pela marcação de acoplamento TUMA ao grânulo (b) O grânulo está sujeito a condições de desprotecção que removem o grupo de proteção seletivamente de A, deixando TUMA protegido. O produto químico B é acoplado ao grânulo, gerando a sequência AB. O grânulo é então sujeito a desproteção que remove seletivamente o grupo protetor de TUMA, e TB é acoplado ao grânulo, gerando a sequência de marcação TUMA TB (c) O terceiro componente C e tag T concomitanteC é adicionado ao grânulo da maneira descrita acima, gerando a sequência de biblioteca ABC e a sequência de marcação TUMA TB TC.

Para grandes bibliotecas contendo três entradas químicas, a sequência de marcação química é a mesma. Assim, para gerar uma grande biblioteca contendo o conjunto completo de três entradas, polímeros de cem unidades de comprimento ou 100 3 = 10 6 membros da biblioteca, identificadores exclusivos são introduzidos de modo que haja um identificador único para cada estrutura química diferente. Teoricamente, este método é aplicável a bibliotecas de qualquer complexidade, desde que sequências de marcação possam ser desenvolvidas com pelo menos o mesmo número de etiquetas de identificação que existem números de estruturas químicas exclusivas na biblioteca.

Embora as estratégias de síntese combinatória forneçam um meio poderoso para identificar rapidamente as moléculas alvo, permanecem problemas substanciais. Por exemplo, uma vez que os membros de bibliotecas endereçáveis ​​espacialmente devem ser sintetizados em matrizes segregadas espacialmente, apenas bibliotecas relativamente pequenas podem ser construídas. A posição de cada vaso de reação em uma biblioteca endereçável espacialmente é definida por um par de coordenadas XY de modo que toda a biblioteca seja definida por uma matriz bidimensional. Conforme o tamanho da biblioteca aumenta, as dimensões da matriz bidimensional aumentam. Além disso, conforme o número de eventos de transformação diferentes usados ​​para construir a biblioteca aumenta linearmente, o tamanho da biblioteca aumenta exponencialmente. Assim, embora a geração do conjunto completo de tetrâmeros lineares composto por quatro entradas diferentes exija apenas uma matriz 16 × 16 (4 4 = 256 membros da biblioteca), a geração do conjunto completo de octâmeros lineares compostos por quatro entradas diferentes requer uma matriz 256 × 256 ( 4 8 = 65.536 membros da biblioteca), e gerar o conjunto completo de tetrâmeros lineares composto de vinte entradas diferentes requer uma matriz 400 × 400 (20 4 = 160.000 membros da biblioteca). Portanto, não apenas o tamanho físico da matriz da biblioteca torna-se rapidamente pesado (construir o conjunto completo de tetrâmeros lineares compostos por vinte entradas diferentes usando técnicas endereçáveis ​​espacialmente requer 1667 placas de microtitulação), mas a entrega de reagentes a cada vaso de reação na matriz requer tanto manipulações manuais tediosas e demoradas ou equipamentos automatizados complexos e caros.

Enquanto o método VLSIPS ™ tenta superar essa limitação por meio da miniaturização, o VLSIPS ™ requer química de fotobloqueio especializada, equipamento de síntese especializado caro e equipamento de ensaio especializado caro. Assim, o método VLSIPS ™ não é prontamente e economicamente adaptável a químicas emergentes de fase sólida e metodologias de ensaio.

Os métodos de contas divididas também sofrem limitações severas. Embora grandes bibliotecas possam teoricamente ser construídas usando métodos de divisão em contas, a identidade dos membros da biblioteca que exibem uma propriedade desejável deve ser determinada por química analítica. Consequentemente, os métodos de esferas divididas só podem ser empregues para sintetizar compostos que podem ser facilmente elucidados por sequenciação em microescala, tais como polipéptidos e polinucleótidos.

Estratégias de co-síntese têm tentado resolver este problema de elucidação de estruturas. No entanto, esses métodos também sofrem limitações. Por exemplo, as estruturas de marcação podem ser incompatíveis com os reagentes e condições da química orgânica sintética. Limitações adicionais decorrem da necessidade de grupos de proteção compatíveis que permitem a co-síntese alternada de etiqueta e membro da biblioteca, e confusão de ensaio que pode surgir a partir das etiquetas que se ligam seletivamente ao receptor de ensaio.

Finalmente, uma vez que métodos como os anteriores normalmente requerem a adição de porções semelhantes, há um interesse substancial na descoberta de métodos para a produção de bibliotecas marcadas de compostos que não estão limitados à adição sequencial de porções semelhantes e que são passíveis de quaisquer químicas agora conhecidas ou que será posteriormente desenvolvido para gerar bibliotecas químicas. Tais métodos teriam aplicação, por exemplo, na modificação de esteróides, açúcares, co-enzimas, inibidores de enzimas, ligantes e semelhantes, que frequentemente envolvem uma síntese de múltiplos estágios em que se desejaria variar os reagentes e / ou condições para fornecer uma variedade de compostos.

Em tais métodos, os reagentes podem ser reagentes orgânicos ou inorgânicos, onde funcionalidades ou grupos laterais podem ser introduzidos, removidos ou modificados, anéis abertos ou fechados, estereoquímica alterada e semelhantes.

Do acima exposto, pode-se reconhecer que há um interesse substancial no desenvolvimento de métodos e aparelhos melhorados para a síntese de bibliotecas químicas combinatórias marcadas com complexo que permitem prontamente a construção de bibliotecas de virtualmente qualquer composição e que permitem prontamente a determinação estrutural precisa de compostos individuais dentro do biblioteca que são identificados como sendo de interesse. Muitas das desvantagens dos métodos descritos anteriormente, bem como muitas das necessidades não satisfeitas por eles, são abordadas pela presente invenção, que é descrita mais completamente a seguir, fornece uma miríade de vantagens sobre esses métodos descritos anteriormente.

Os termos a seguir pretendem ter os seguintes significados gerais conforme são usados ​​aqui:

Biblioteca de Oligômero Sintético Marcado: Uma "biblioteca de oligômero sintético marcado" é uma coleção de oligômeros sintéticos aleatórios em que cada membro de tal biblioteca é marcado com uma etiqueta identificadora única a partir da qual a estrutura ou sequência de cada oligômero pode ser deduzida.

Etiqueta identificadora: Uma "etiqueta identificadora" é qualquer atributo detectável que fornece um meio pelo qual se pode elucidar a estrutura de um oligômero individual em uma biblioteca de oligômeros sintéticos rotulados. Assim, uma etiqueta identificadora identifica quais eventos de transformação um oligômero individual experimentou na síntese de uma biblioteca de oligômero sintético marcado, e em qual ciclo de reação em uma série de ciclos de síntese cada evento de transformação foi experimentado.

Uma etiqueta identificadora pode ser qualquer característica detectável, incluindo, por exemplo: uma absorbância diferencial ou emissão de luz magnética ou informação pré-codificada eletronicamente ou qualquer outra marca distintiva com a informação necessária. Uma etiqueta identificadora pode ser pré-codificada com informações de identificador únicas antes da síntese de uma biblioteca de oligômeros sintéticos rotulados, ou pode ser codificada com uma informação de identificador concomitantemente com uma biblioteca de oligômeros sintéticos rotulados.

Nesta última modalidade, a informação identificadora adicionada em cada ciclo de síntese é preferencialmente adicionada de uma forma sequencial, tal como, por exemplo, informação digital, com a informação identificadora identificando o evento de transformação do ciclo de síntese dois sendo anexada à informação identificadora que identifica a transformação evento do ciclo de síntese um, e assim por diante.

De preferência, uma etiqueta identificadora é impermeável às condições de reação usadas para construir a biblioteca de oligômeros sintéticos marcados.

Um exemplo preferido de uma etiqueta identificadora é um microchip que é pré-codificado ou codificável com informação, cuja informação é relacionada de volta a um detector quando o microchip é pulsado com radiação eletromagnética.

Etiqueta identificadora pré-codificada: Uma "etiqueta identificadora pré-codificada" é uma etiqueta identificadora que é pré-codificada com informações de identificador exclusivo antes da síntese de uma biblioteca de oligômero sintético rotulado. Um exemplo preferido de tal etiqueta identificadora pré-codificada é um microchip que é pré-codificado com informação, cuja informação é relacionada de volta a um detector quando o microchip é pulsado com radiação eletromagnética.

Tag identificadora codificável: Uma "tag identificadora codificável" é uma tag identificadora que é capaz de receber informações do identificador de tempos em tempos. Uma etiqueta de identificador codificável pode ou não ser pré-codificada com informação de identificador parcial ou completa antes da síntese de uma biblioteca de oligômero sintético marcado. Um exemplo preferido de tal etiqueta identificadora codificável é um microchip que é capaz de receber e armazenar informações de tempos em tempos, informações essas que são relacionadas a um detector quando o microchip é pulsado com radiação eletromagnética.

Evento de transformação: conforme usado neste documento, um "evento de transformação" é qualquer evento que resulte em uma alteração da estrutura química de um oligômero ou polímero. Um "evento de transformação" pode ser mediado por meios físicos, químicos, enzimáticos, biológicos ou outros, ou uma combinação de meios, incluindo, mas não se limitando a, foto, química, enzimática ou biologicamente mediada por isomerização ou foto de clivagem, química, enzimática ou biologicamente grupo lateral mediado ou adição de grupo funcional, remoção ou modificação de mudanças nas mudanças de temperatura na pressão e semelhantes. Assim, "evento de transformação" inclui, mas não está limitado a, eventos que resultam em um aumento no peso molecular de um oligômero ou polímero, como, por exemplo, a adição de um ou uma pluralidade de monômeros, adição de solvente ou gás, ou coordenação de metal ou outros substratos inorgânicos, como, por exemplo, eventos de zeólitos que resultam em uma diminuição no peso molecular de um oligômero ou polímero, tal como, por exemplo, desidrogenação de um álcool para formar um alceno ou hidrólise enzimática de um éster ou amida eventos que resultam em nenhuma mudança líquida no peso molecular de um oligômero ou polímero, como, por exemplo, alterações estereoquímicas em um ou uma pluralidade de centros quirais, rearranjo de Claissen ou rearranjo de Cope e outros eventos que se tornarão aparente para aqueles versados ​​na técnica após a revisão desta divulgação. Ver, por exemplo, a aplicação Ser. No. 08 / 180.863 depositado em 13 de janeiro de 1994, que é atribuído ao cessionário da presente invenção e Publicação PCT WO 94/08051 intitulada "Complex Combinatorial Libraries Encoded with Tags", 14 de abril (1994), cada um dos quais é aqui incorporado por referência.

Monômero: Como usado aqui, um "monômero" tem o mesmo significado conforme definido abaixo.

Oligômero ou Polímero: Tal como aqui utilizado, um "oligômero" ou "polímero" é qualquer estrutura química que pode ser sintetizada usando os métodos da biblioteca combinatória desta invenção, incluindo, por exemplo, amidas, ésteres, tioéteres, cetonas, éteres, sulfóxidos, sulfonamidas, sulfonas, fosfatos, álcoois, aldeídos, alcenos, alcinos, aromáticos, poliaromáticos, compostos heterocíclicos contendo um ou mais dos átomos de: nitrogênio, enxofre, oxigênio e fósforo e entidades químicas semelhantes com uma estrutura central comum, como , por exemplo, terpenos, esteróides, β-lactamas, benzodiazepinas, xantatos, indóis, indolonas, lactonas, lactamas, hidantoínas, quinonas, hidroquinonas e cadeias semelhantes de unidades monoméricas repetidas, como polissacarídeos, fosfolipídeos, poliuretanos, poliésteres, policarbonatos, poli ureias, poliamidas, polietilenoiminas, sulfuretos de poliarileno, poliimidas, poliacetatos, polipeptídeos, polinucleotídeos e semelhantes ou outros oligômeros ou polímeros como serão facilmente aplicáveis não é para um especialista na técnica após a revisão desta divulgação. Assim, um "oligômero" e "polímero" da presente invenção pode ser linear, ramificado, cíclico ou assumir várias outras formas, como será evidente para os versados ​​na técnica.

Combinado: Como usado aqui, "coordenado" significa formação síncrona e assíncrona de uma ou mais ligações químicas em uma única etapa de reação.

Substrato: Tal como aqui utilizado, um "substrato" é um meio de síntese ligado a uma etiqueta identificadora. A título de exemplo e não de limitação, um "substrato" pode ser uma etiqueta identificadora funcionalizada com um ou uma pluralidade de grupos ou ligantes adequados para a síntese de uma etiqueta identificadora encerrada em vidro ou polímero, cujo vidro ou polímero é funcionalizado com um ou uma pluralidade de grupos ou ligantes adequados para a síntese uma etiqueta identificadora que é revestida com um ou uma pluralidade de sínteses suporta uma etiqueta identificadora retida dentro de uma estrutura ou alojamento, cujo quadro ou alojamento é funcionalizado com um ou uma pluralidade de grupos ou ligantes adequados para a síntese de um identificador etiqueta retida dentro de uma estrutura ou alojamento, cuja estrutura ou alojamento também retém um ou uma pluralidade de suportes de síntese e semelhantes.

Meios de Síntese: Um "meio de síntese" é qualquer meio para realizar a síntese de uma biblioteca de oligômeros sintéticos marcados. Assim, "meios de síntese" podem compreender vasos de reação, colunas, capilares, estruturas, invólucros e semelhantes, adequados para a realização de reações de síntese um ou uma pluralidade de suportes de síntese adequados para a realização de reações de síntese ou grupos funcionais ou ligantes ligados a um etiqueta identificadora adequada para a realização de reações de síntese.

"Meios de síntese" podem ser construídos de modo que sejam capazes de reter etiquetas de identificação e / ou suportes de síntese.

Em uma modalidade preferida, um "meio de síntese" é um ou uma pluralidade de suportes de síntese.

Suporte de Síntese: Um "suporte de síntese" é um material tendo uma superfície rígida ou semirrígida e tendo grupos funcionais ou ligantes, ou que é capaz de ser derivatizado com grupos funcionais ou ligantes, que são adequados para a realização de reações de síntese.

Tais materiais irão, de preferência, tomar a forma de pequenas contas, peletes, discos, capilares, fibras ocas, agulhas, fibras sólidas, contas de celulose, contas de vidro poroso, géis de sílica, contas de poliestireno opcionalmente reticuladas com polietilenoglicol divinilbenzeno, co- enxertado poli contas, poli-acrilamida. contas, contas de látex, contas de dimetilacrilamida opcionalmente reticuladas com N, N'-bis-acriloil etilenodiamina, partículas de vidro revestidas com um polímero hidrofóbico ou outras formas convenientes.

"Suportes de síntese" podem ser construídos de modo que sejam capazes de reter etiquetas de identificação.

Ligante: Um "ligante" é uma porção, molécula ou grupo de moléculas ligadas a um suporte de síntese ou substrato e espaçando um polímero ou oligômero sintetizado do suporte de síntese ou substrato. Um "ligante" também pode ser uma porção, molécula ou grupo de moléculas ligadas a um substrato e espaçando um suporte de síntese do substrato.

Normalmente, um ligante será bi-funcional, em que o referido ligante tem um grupo funcional em uma extremidade capaz de se ligar a um monômero, oligômero, suporte de síntese ou substrato, uma série de resíduos espaçadores e um grupo funcional em outra extremidade capaz de se ligar a um monômero, oligômero, suporte de síntese ou substrato. Os grupos funcionais podem ser, mas não precisam ser, idênticos.

Resíduos espaçadores: "Resíduos espaçadores" são átomos ou moléculas posicionadas entre os grupos funcionais de um ligante bifuncional ou entre um grupo funcional de um ligante e a porção à qual o ligante está ligado. "Resíduos espaçadores" podem ser átomos capazes de formar pelo menos duas ligações covalentes, como carbono, silício, oxigênio, enxofre, fósforo e semelhantes, ou podem ser moléculas capazes de formar pelo menos duas ligações covalentes, como aminoácidos, peptídeos, nucleosídeos, nucleotídeos, açúcares, carboidratos, anéis aromáticos, anéis de hidrocarbonetos, hidrocarbonetos lineares e ramificados e semelhantes.

Ligados uns aos outros, os resíduos espaçadores podem ser rígidos, semirrígidos ou flexíveis. Resíduos espaçadores ligados podem ser, mas não precisam ser, idênticos.

Substrato pré-codificado: Um "substrato pré-codificado" é um substrato em que a etiqueta identificadora é uma etiqueta identificadora pré-codificada.

Substrato codificável: Um "substrato codificável" é um substrato em que a etiqueta identificadora é uma etiqueta identificadora codificável.

Sintético: Um composto é "sintético" quando produzido por síntese química ou enzimática in vitro.

Oligômero ou sequência de polímero: Como aqui utilizado, "sequência de oligômero" ou "sequência de polímero" refere-se à estrutura química de um oligômero ou polímero.

A presente invenção refere-se a bibliotecas marcadas de oligômeros aleatórios. Cada membro da biblioteca é rotulado com uma etiqueta de identificação única, a partir da qual a estrutura do membro da biblioteca pode ser facilmente verificada.

A presente invenção também se refere a métodos e aparelhos para sintetizar bibliotecas marcadas de oligômeros aleatórios. Os oligômeros aleatórios são geralmente sintetizados em suportes de síntese, mas podem ser clivados desses suportes ou sintetizados em fase de solução para fornecer uma biblioteca solúvel. Em uma modalidade preferida, os oligômeros são compostos por um conjunto de monômeros, sendo os monômeros qualquer membro do conjunto de átomos ou moléculas que podem ser unidos para formar um oligômero ou polímero. A biblioteca é então rastreada para isolar oligômeros individuais que se ligam a um receptor ou possuem alguma propriedade desejada. Em uma modalidade preferida, cada estrutura de oligômero na biblioteca é única.

A etiqueta identificadora é usada para identificar as estruturas de oligômeros contidos na biblioteca de oligômeros sintéticos rotulados. A etiqueta identificadora, que pode estar ligada ao oligômero em uma variedade de formas, pode ser qualquer característica detectável que de alguma forma carregue a informação necessária e que seja decifrável. De preferência, a etiqueta identificadora é impermeável aos reagentes químicos usados ​​para sintetizar a biblioteca.

Em uma modalidade preferida, a etiqueta identificadora relaciona um sinal a um detector após excitação com radiação eletromagnética. As etiquetas de identificação adequadas podem ser, a título de exemplo e não de limitação, códigos de barras que podem ser digitalizados com um laser, porções químicas que emitem ou absorvem luz diferencialmente, como cromóforos, porções fluorescentes e fosforescentes ou microchips que são pré-codificados ou são codificáveis ​​com uma "impressão digital" de radiofrequência única que emite um sinal detectável quando pulsada com radiação eletromagnética.

Numa outra forma de realização preferida, as etiquetas de identificação são encerradas em vidro ou um material polimérico que pode ser revestido com suportes de síntese ou derivatizado com grupos funcionais ou ligantes adequados para a síntese. De preferência, as etiquetas de identificação podem ser classificadas com equipamento de classificação automática. Esses materiais poliméricos e equipamentos de classificação são amplamente conhecidos na técnica.

BREVE DESCRIÇÃO DAS FIGURAS

FIGO. 1 ilustra esquematicamente a síntese do conjunto completo de trímeros lineares compostos por quatro entradas de monômero diferentes usando etiquetas de identificador pré-codificadas.

FIGO. 2 ilustra esquematicamente a montagem do conjunto completo de trímeros lineares compostos por quatro entradas de monômero diferentes, em que as etiquetas de identificação são codificadas com informações de identificador em paralelo com a síntese de oligômero.

FIGO. 3 ilustra esquematicamente a síntese de uma biblioteca rotulada de oligômeros composta por quatro entradas de monômero diferentes e tendo uma estrutura de núcleo comum usando etiquetas de identificador pré-codificadas.

FIGO. 4 ilustra esquematicamente a síntese de uma biblioteca marcada de oligômeros composta por quatro entradas de monômeros diferentes e tendo uma estrutura central comum em que as marcas de identificador são codificadas com informações de identificador em paralelo com a síntese de oligômero.

FIGO. 5 ilustra esquematicamente a síntese de uma biblioteca marcada de oligômeros construída usando uma série de síntese de ciclo múltiplo com uma pluralidade de eventos de transformação diferentes usando identificadores pré-codificados.

FIGO. 6 ilustra esquematicamente a síntese de uma biblioteca marcada de oligômeros construída usando uma série de síntese de ciclo múltiplo com uma pluralidade de eventos de transformação diferentes, em que as marcas identificadoras são codificadas em paralelo com a síntese de oligômero.

FIGO. 7 ilustra esquematicamente várias maneiras em que uma etiqueta identificadora pode ser ligada a um membro da biblioteca de oligômeros.

DESCRIÇÃO DETALHADA DA INVENÇÃO

A presente invenção fornece bibliotecas sintéticas marcadas de oligômeros aleatórios e métodos e aparelhos para gerar bibliotecas de oligômeros sintéticos marcados. Cada membro dessa biblioteca é rotulado com uma etiqueta identificadora única que especifica a estrutura ou sequência do oligômero. Numa forma de realização preferida da presente invenção, a etiqueta identificadora é um microchip que é pré-codificado ou codificável com informação que está relacionada de volta a um detector quando a etiqueta identificadora é pulsada com radiação eletromagnética.

I. Bibliotecas de oligômeros rotulados

A presente invenção refere-se a bibliotecas marcadas de oligômeros aleatórios. Cada membro de uma biblioteca de oligômeros aleatória está ligado a uma etiqueta identificadora de modo que a estrutura do membro da biblioteca de oligômeros possa ser facilmente verificada. A biblioteca de oligômeros aleatórios geralmente compreende uma coleção altamente diversa de oligômeros, em que cada membro de tal biblioteca compreende uma única estrutura de oligômero (por exemplo, uma benzodiazepina). Os oligômeros podem ser solúveis ou podem ser ligados a um suporte de síntese ou substrato.

Os membros da biblioteca podem ser vinculados a uma etiqueta identificadora em uma variedade de modos. Veja, por exemplo, a FIG. 7. Por exemplo, um membro da biblioteca de oligômeros pode ser anexado a um suporte de síntese, cujo suporte de síntese é retido dentro de um recipiente de reação, estrutura ou alojamento que também retém uma etiqueta identificadora. Como outro exemplo, um membro da biblioteca pode ser anexado a um suporte de síntese que por sua vez é anexado a uma etiqueta identificadora. O membro da biblioteca pode ser anexado diretamente a um grupo funcional no suporte de síntese, mas geralmente será anexado por meio de um linker. O ligante será geralmente um ligante bi-funcional, cujo ligante bi-funcional compreende um grupo funcional capaz de se ligar a um monômero, oligômero, suporte de síntese ou substrato em uma extremidade, uma série de resíduos espaçadores e um grupo funcional capaz de se ligar a um monômero, oligômero ou suporte de síntese ou substrato em outra extremidade.

A ligação de um suporte de síntese a uma etiqueta identificadora pode ser mediada por uma variedade de meios. Por exemplo, uma etiqueta identificadora pode ser revestida com um ou uma pluralidade de suportes de síntese, cujos suportes de síntese são fixados à etiqueta identificadora por meios físicos, como cola ou atração magnética. Em uma modalidade, um suporte de síntese pode ser um polímero capaz de ser funcionalizado com grupos reativos ou ligantes, cujo suporte de síntese é moldado em uma estrutura ou alojamento que retém uma etiqueta identificadora.

Alternativamente, um ou uma pluralidade de suportes de síntese podem ser covalentemente ligados a uma etiqueta identificadora. A ligação covalente pode ser diretamente a um grupo funcional na etiqueta identificadora ou pode ser mediada por um ligante como descrito acima.

Em outra modalidade, um membro da biblioteca pode ser anexado diretamente a um grupo funcional em uma etiqueta identificadora ou a um ligante que está anexado a um grupo funcional em uma etiqueta identificadora.

Os suportes e substratos de síntese podem ter uma pluralidade de grupos funcionais ou ligantes, de modo que cada suporte ou substrato de síntese pode ter uma pluralidade de membros da biblioteca de oligômeros de sequência idêntica a eles ligados. A quantidade sintetizada de cada membro da biblioteca que compreende a biblioteca de oligômeros marcados pode ser variada variando o número de suportes de síntese, grupos funcionais ou ligantes em suportes de síntese, ou grupos funcionais ou ligantes em substratos. Assim, a biblioteca de oligômeros marcados da presente invenção pode compreender quantidades em miligramas de cada estrutura de membro da biblioteca, proporcionando assim uma quantidade suficiente de cada membro da biblioteca para múltiplos ensaios ou outras experiências analíticas.

As bibliotecas de oligômeros marcados da presente invenção geralmente compreendem uma coleção altamente diversa de oligômeros. Tal biblioteca pode conter, por exemplo, todos os N X diferentes oligômeros, em que cada oligômero é sintetizado em uma série de X ciclos de síntese usando N diferentes eventos de transformação. Como um exemplo específico, uma biblioteca pode conter todas as combinações de N X diferentes oligômeros, cujos oligômeros são compostos de N diferentes monômeros montados em X ciclos de síntese.

A biblioteca também pode conter oligômeros que foram sintetizados com diferentes eventos de transformação em, por exemplo, apenas um ou um pequeno número de ciclos na série de síntese, embora tendo eventos de transformação idênticos em todos os outros ciclos. Como um exemplo específico, uma biblioteca pode conter oligômeros com monômeros diferentes em apenas uma ou um pequeno número de posições, embora tenha monômeros idênticos em todas as outras posições.

Os oligômeros ou polímeros da presente invenção são formados a partir de uma série gradual ou combinada de eventos de transformação. Um evento de transformação é qualquer evento que resulta em uma mudança na estrutura química de um oligômero ou polímero. Um evento de transformação pode ser mediado por meios físicos, químicos, enzimáticos, biológicos ou outros, ou uma combinação de meios, incluindo, mas não se limitando a, foto, química, enzimática ou mediada biologicamente isomerização ou foto de clivagem, lado químico, enzimático ou mediado biologicamente adição, remoção ou modificação de grupo ou grupo funcional mudanças em mudanças de temperatura na pressão e semelhantes. Assim, eventos de transformação incluem, mas não estão limitados a, eventos que resultam em um aumento no peso molecular de um oligômero ou polímero, como, por exemplo, adição de um ou uma pluralidade de monômeros, adição de solvente ou gás ou coordenação de metal ou outros substratos inorgânicos, tais como, por exemplo, eventos de zeólitos que resultam em uma diminuição no peso molecular de um oligômero ou polímero, tal como, por exemplo, desidrogenação de um álcool a partir de um alceno, ou hidrólise enzimática de um éster ou amida eventos que resultam em nenhuma mudança líquida no peso molecular de um oligômero ou polímero, como, por exemplo, mudanças estereoquímicas em um ou uma pluralidade de centros quirais, rearranjo de Claissen ou rearranjo de Cope e outros eventos que se tornarão aparentes para os versados na arte após a revisão desta divulgação. Ver, por exemplo, a aplicação Ser. No. 08 / 180.863 depositado em 13 de janeiro de 1994, que é atribuído ao cessionário da presente invenção e Publicação PCT WO 94/08051 intitulada "Complex Combinatorial Libraries Encoded with Tags", 14 de abril (1994), cada um dos quais é aqui incorporado por referência.

Em uma modalidade preferida, pelo menos um evento de transformação na geração de uma biblioteca de oligômeros sintéticos marcados é a adição enzimática ou química em etapas ou combinada de um ou uma pluralidade de monômeros.

Em outra modalidade preferida, cada evento de transformação na geração de uma biblioteca de oligômero sintético marcado é a adição enzimática ou química em etapas ou combinada de um ou uma pluralidade de monômeros.

Um monômero é qualquer átomo ou molécula capaz de formar pelo menos uma ligação química. Assim, um monômero é qualquer membro do conjunto de átomos ou moléculas que podem ser unidos como unidades únicas em um múltiplo de etapas de reação química ou enzimática sequenciais ou combinadas para formar um oligômero ou polímero. O conjunto de monômeros úteis na presente invenção inclui, mas não está restrito a alquil e arilaminas alquil e aril mercaptans alquil e aril cetonas alquil e aril carboxílicos ácidos alquil e aril éteres alquil e aril éteres alquil e aril sulfóxidos alquil e aril sulfonas alquil e aril sulfonamidas fenóis alquil álcoois alquil e aril alquenos alquil e aril lactamas alquil e aril lactonas alquil e aril di- e polienos alquil e aril alquines alquil e aril cetonas insaturadas aldeídos sulfóxidos sulfonas compostos heteroatômicos contendo um ou mais dos átomos de: nitrogênio , enxofre, fósforo, oxigênio e outras moléculas polifuncionais contendo um ou mais dos grupos funcionais acima L-aminoácidos D-aminoácidos desoxirribonucleosídeos desoxirribonucleotídeos ribonucleosídeos ribonucleotídeos açúcares benzodiazepinas β-lactâmicos hidantoínas quinonas hidroquinonas terpenos e semelhantes.

Os monômeros da presente invenção podem ter grupos que protegem os grupos funcionais dentro do monômero. Os grupos de proteção adequados dependerão da funcionalidade e da química particular usada para construir a biblioteca. Exemplos de grupos de proteção funcionais adequados serão prontamente aparentes para os versados ​​na técnica e são descritos, por exemplo, em Greene e Wutz, Protecting Groups in Organic Synthesis, 2a ed., John Wiley & Sons, NY (1991), que é incorporado aqui por referência.

Conforme usado neste documento, monômero se refere a qualquer membro de um conjunto de base para a síntese de um oligômero. Por exemplo, dímeros de L-aminoácidos formam um conjunto básico de 400 "monômeros" para a síntese de polipeptídeos. Diferentes conjuntos básicos de monômeros podem ser usados ​​em etapas sucessivas na síntese de um polímero. Assim, como o versado na técnica apreciará, os membros da biblioteca de oligômeros ou polímeros gerados pela prática da presente invenção podem servir como monômeros na síntese de bibliotecas de oligômeros sintéticos marcados.

Consequentemente, os oligômeros ou polímeros da presente invenção compreendem qualquer estrutura química que pode ser sintetizada usando os métodos da biblioteca combinatória desta invenção, incluindo, por exemplo, amidas, ésteres, tioéteres, cetonas, éteres, sulfóxidos, sulfonamidas, sulfonas, fosfatos, álcoois , aldeídos, alcenos, alcinos, aromáticos, poliaromáticos, compostos heterocíclicos contendo um ou mais dos átomos de: nitrogênio, enxofre, oxigênio e fósforo e entidades químicas semelhantes com uma estrutura central comum, como, por exemplo, terpenos, esteróides , β-lactamas, benzodiazepinas, xantatos, indóis, indolonas, lactonas, lactamas, hidantoínas, quinonas, hidroquinonas e cadeias semelhantes de unidades monoméricas repetidas, tais como polissacarídeos, fosfolipídeos, poliuretanos, poliésteres, policarbonatos, poli ureases, poliamidas, polietilenoiminas, sulfuretos de poliarileno, poliimidas, poliacetatos, polipeptídeos, polinucleotídeos e semelhantes ou outros oligômeros ou polímeros como será prontamente um aparente para um especialista na técnica após a revisão desta divulgação. Assim, um "oligômero" e "polímero" da presente invenção pode ser linear, ramificado, cíclico ou assumir várias outras formas, como será evidente para os versados ​​na técnica.

Uma biblioteca de oligômeros marcados da presente invenção pode compreender virtualmente qualquer nível de complexidade e é limitada em tamanho apenas pelo tamanho físico de um substrato. Uma biblioteca de oligômeros compreenderá tipicamente de cerca de 10 a cerca de 5.000 membros da biblioteca, preferencialmente de cerca de 1.000 a cerca de 250.000 membros da biblioteca, e mais preferencialmente de cerca de 50.000 a cerca de 106 membros da biblioteca.

As bibliotecas de oligômeros sintéticos marcados da presente invenção têm uma ampla variedade de usos. A título de exemplo e não de limitação, bibliotecas de oligômeros sintéticos marcados podem ser usadas para identificar peptídeos, ácidos nucleicos, carboidratos e / ou outras estruturas que se ligam a proteínas, enzimas, anticorpos, receptores e semelhantes identificar drogas de ligação específicas de sequência identificar epítopos reconhecidos por anticorpos avaliar uma variedade de drogas para aplicações de diagnóstico clínico identificar materiais que exibem propriedades específicas, tais como, por exemplo, elementos de identificação de cerâmica compreendendo combinações de composições supercondutoras dos anteriores e outros usos que serão evidentes para aqueles versados ​​na técnica.

II. Métodos para gerar bibliotecas de oligômeros rotulados

A presente invenção também fornece métodos e aparelhos para gerar bibliotecas de oligômeros marcados. Os métodos gerais envolvem tipicamente a síntese dos oligômeros de uma forma combinatória aleatória por uma série gradual ou combinada de eventos de transformação. Uma biblioteca de oligômeros marcados pode ser produzida sintetizando em cada uma de uma pluralidade de marcadores identificadores ligados a um meio de síntese ("substratos") uma única estrutura de oligômero, a estrutura de oligômero sendo diferente para diferentes substratos.

Os substratos usados ​​para praticar os métodos da presente invenção incluem, mas não estão limitados a, uma etiqueta identificadora funcionalizada com um ou uma pluralidade de grupos ou ligantes adequados para a síntese de uma etiqueta identificadora encerrada em vidro ou polímero, cujo vidro ou polímero é funcionalizado com uma ou uma pluralidade de grupos ou ligantes adequados para a síntese, uma etiqueta identificadora que é revestida com um ou uma pluralidade de sínteses suporta uma etiqueta identificadora retida dentro de uma estrutura ou alojamento, cuja estrutura ou alojamento é funcionalizada com um ou uma pluralidade de grupos ou ligantes adequados para a síntese, uma etiqueta identificadora retida dentro de uma estrutura ou alojamento, cujo quadro ou alojamento também retém um ou uma pluralidade de suportes de síntese e semelhantes.

Numa forma de realização preferida, um substrato compreende uma etiqueta identificadora retida dentro de uma estrutura ou caixa, estrutura ou caixa essa que também retém um ou uma pluralidade de suportes de síntese.

Em outra modalidade preferida, um substrato compreende uma etiqueta identificadora retida dentro de uma estrutura ou alojamento, cuja estrutura ou alojamento é funcionalizado com um ou uma pluralidade de grupos ou ligantes adequados para a síntese.

Ainda noutra forma de realiza�o preferida, um substrato compreende uma etiqueta identificadora, opcionalmente envolvida num vidro ou revestimento polim�ico, etiqueta identificadora essa funcionalizada com um ou uma pluralidade de grupos ou ligantes adequados para s�tese.

Em uma modalidade dos métodos da presente invenção, é gerada uma biblioteca de oligômeros sintéticos marcados que emprega marcadores identificadores de "nascimento até a morte". Uma etiqueta identificadora de "nascimento até a morte" é uma etiqueta cujo conteúdo de informação não muda durante o curso da síntese.Uma biblioteca de oligômero sintético rotulado é sintetizada em um processo que compreende as etapas de: (a) distribuição de uma pluralidade de substratos, cada um dos quais é pré-codificado com uma etiqueta de identificação única ("substratos pré-codificados") entre uma pluralidade de vasos de reação (b) expor os substratos pré-codificados em cada recipiente de reação a um ou uma pluralidade de eventos de transformação (c) detectar e registrar as informações da etiqueta identificadora de cada substrato pré-codificado em cada recipiente de reação (d) distribuir o pré-codificado substratos entre uma pluralidade de vasos de reação e (e) repetição das etapas (a) a (c) de pelo menos uma a cerca de vinte vezes.

Uma etapa de capeamento em que grupos funcionais que não reagiram após um evento de transformação são "capeados" com uma porção química altamente reativa específica para o (s) grupo (s) funcional (is) desejado (s) a serem capeados pode ser usada após cada evento de transformação. As porções de proteção química adequadas são bem conhecidas na técnica.

Normalmente, números substancialmente iguais de substratos serão distribuídos em cada vaso de reação. Os substratos podem ser distribuídos de forma estocástica em cada etapa, mas preferencialmente serão distribuídos de forma não estocástica.

Em uma modalidade preferida, pelo menos um evento de transformação é a adição gradual ou combinada de substâncias químicas ou enzimáticas de uma ou uma pluralidade de unidades monoméricas.

Em uma modalidade ainda mais preferida, cada evento de transformação é a adição gradual ou combinada de substâncias químicas ou enzimáticas de uma ou uma pluralidade de unidades monoméricas. Para esta modalidade preferida, uma biblioteca de oligômero sintético marcado é sintetizada em um processo que compreende as etapas de: (a) distribuição de uma pluralidade de substratos pré-codificados entre uma pluralidade de vasos de reação (b) expondo os substratos pré-codificados em cada vaso de reação a uma ou uma pluralidade de unidades monoméricas (c) detectar e registrar as informações da etiqueta identificadora de cada substrato pré-codificado em cada recipiente de reação (d) distribuir os substratos pré-codificados entre uma pluralidade de recipientes de reação e (e) repetir as etapas (a) a (c) de pelo menos uma a cerca de vinte vezes.

Uma etapa de capeamento em que grupos funcionais não reagidos após a adição de um ou uma pluralidade de monômeros são "capeados" com uma porção química altamente reativa específica para o (s) grupo (s) funcional (is) desejado (s) a serem capeados pode ser usada após cada ciclo de reação. As porções de proteção química adequadas são bem conhecidas na técnica.

Como um exemplo específico do método, pode-se considerar a síntese do conjunto de oligômeros lineares com três resíduos de monômeros de comprimento, montados a partir de um conjunto de quatro monômeros A, B, C, D. Ver FIG. 1. O primeiro monômero é acoplado a quatro alíquotas diferentes de substratos pré-codificados, cada monômero diferente em uma alíquota diferente. As informações do identificador de cada substrato pré-codificado são detectadas e registradas para cada alíquota diferente. Os substratos pré-codificados de todas as alíquotas são então redistribuídos para uma segunda rodada de adição de monômero.

Os substratos pré-codificados podem ser redistribuídos de forma estocástica. Para este método, os substratos pré-codificados de todas as alíquotas são agrupados, cujo conjunto agora contém números aproximadamente iguais de quatro tipos diferentes de substratos pré-codificados, cada um dos quais é caracterizado pelo monômero na posição do primeiro resíduo e redistribuído em os vasos de reação de monômero separados contendo A, B, C ou D como o monômero. Alternativamente, os substratos pré-codificados podem ser classificados e redistribuídos de uma forma não estocástica nos vasos de reação de monômero separados contendo A, B, C ou D como o monômero.

Após a redistribuição, um segundo monômero é acoplado e a informação identificadora de cada substrato pré-codificado novamente detectada e registrada para cada substrato em cada recipiente de reação. Cada vaso agora tem substratos com quatro monômeros diferentes na posição um e o monômero contido em cada segundo vaso de reação particular na posição dois. Os substratos pré-codificados de todos os vasos de reação são novamente redistribuídos entre cada um dos quatro vasos de reação e o processo de acoplamento, detecção e registro é repetido. O processo de acoplamento sequencial e distribuição produz substratos pré-codificados que passaram por todas as vias de reação possíveis, e a coleção de substratos pré-codificados exibe todos os trímeros possíveis compostos das quatro entradas de monômero A, B, C e D (4 3 = 64 trímeros).

As etapas sequenciais de detecção e registro forneceram uma lista detalhada das adições de monômero graduais às quais cada substrato pré-codificado foi submetido ("histograma de reação"). Por exemplo, se a sequência de trímero ABC foi sintetizada em um substrato pré-codificado com sinal de etiqueta identificadora "001", o histograma de reação registrado revelaria que na primeira etapa de reação o substrato 001 estava contido no recipiente de reação contendo monômero A, no o substrato da segunda etapa de reação 001 estava contido no recipiente de reação contendo monômero B, e na terceira etapa no recipiente contendo monômero C. Assim, determinar em qual recipiente de reação um substrato pré-codificado particular estava contido em cada etapa de reação revela a estrutura do polímero ou sequência sintetizada no substrato pré-codificado particular. Assim, pode ser apreciado que o número de etiquetas identificadoras únicas necessárias para rotular a biblioteca é ditado pelo número de membros na biblioteca que está sendo gerada.

Em outra modalidade da presente invenção, as etiquetas de identificação são codificadas com informações em paralelo com a geração da biblioteca de oligômeros ("substratos codificáveis"). Os substratos codificáveis ​​podem ser pré-codificados com informações identificadoras parciais antes da síntese ou podem estar em branco. Uma biblioteca de oligômeros sintéticos rotulados é sintetizada em um processo que compreende as etapas de: (a) repartir uma pluralidade de substratos codificáveis ​​entre uma pluralidade de vasos de reação (b) expor os substratos em cada vaso de reação a um ou uma pluralidade de eventos de transformação (c ) adicionar informações de identificador a cada etiqueta identificadora em cada recipiente de reação (d) distribuir os substratos codificáveis ​​entre uma pluralidade de recipientes de reação e (e) repetir as etapas (a) a (c) de pelo menos uma a cerca de vinte vezes.

Uma etapa de capeamento em que grupos funcionais que não reagiram após um evento de transformação são "capeados" com uma porção química altamente reativa específica para o (s) grupo (s) funcional (is) desejado (s) a serem capeados pode ser usada após cada evento de transformação. As porções de proteção química adequadas são bem conhecidas na técnica.

Em uma modalidade preferida, pelo menos um evento de transformação é a adição gradual ou combinada de substâncias químicas ou enzimáticas de uma ou uma pluralidade de unidades monoméricas.

Em uma modalidade ainda mais preferida, cada evento de transformação é a adição gradual ou combinada de substâncias químicas ou enzimáticas de uma ou uma pluralidade de unidades monoméricas. Para esta modalidade preferida, uma biblioteca de oligômero sintético marcado é sintetizada em um processo que compreende as etapas de: (a) distribuição de uma pluralidade de substratos codificáveis ​​entre uma pluralidade de vasos de reação (b) expondo os substratos em cada vaso de reação a um ou a uma pluralidade de unidades (c) adicionar informações identificadoras a cada etiqueta identificadora em cada recipiente de reação (d) distribuir os substratos codificáveis ​​entre uma pluralidade de recipientes de reação e (e) repetir as etapas (a) a (c) de pelo menos uma a cerca de vinte vezes .

Uma etapa de capeamento em que grupos funcionais não reagidos após adição de uma ou uma pluralidade de unidades monoméricas são "capeados" com uma fração química altamente reativa específica para o (s) grupo (s) funcional (is) desejado (s) a ser tampado (s) pode ser usado após cada ciclo de reação. As porções de proteção química adequadas são bem conhecidas na técnica.

Normalmente, números substancialmente iguais de substratos serão distribuídos em cada vaso de reação. Conforme discutido acima, o processo de redistribuição pode ser estocástico, mas é preferencialmente não estocástico.

Como um exemplo específico do método, pode-se considerar novamente a síntese do conjunto de oligômeros de três resíduos de comprimento, montado a partir de um conjunto de monômeros A, B, C, D. Ver FIG. 2. O primeiro monômero é acoplado a quatro alíquotas diferentes de substratos codificáveis, cada monômero diferente em uma alíquota diferente. As informações do identificador são adicionadas às tags do identificador em cada alíquota, com as informações do identificador sendo exclusivas para cada alíquota. Assim, cada substrato codificável é caracterizado pela identidade do monômero na posição do primeiro resíduo. Os substratos codificáveis ​​são então redistribuídos entre os vasos de reação de monômero separados contendo A, B, C ou D como o monômero.

O segundo resíduo é acoplado e a informação do identificador é única para cada alíquota adicionada aos substratos codificáveis ​​em cada vaso de reação. Após esta reação, cada vaso agora tem substratos codificáveis ​​com quatro monômeros diferentes na posição um e o monômero contido em cada segundo vaso de reação particular na posição dois. Os substratos codificáveis ​​de todos os vasos de reação são novamente redistribuídos entre cada um dos quatro vasos de reação, o terceiro monômero acoplado e as informações de identificação adicionadas. O processo de redistribuição e acoplamento sequencial produz substratos que passaram por todas as vias de reação possíveis, e a coleção de substratos exibe todos os trímeros possíveis compostos de A, B, C e D (4 3 = 64 trímeros).

Cada etiqueta identificadora agora é rotulada com informações sequenciais que identificam os monômeros aos quais cada substrato codificável foi exposto. Por exemplo, se forem atribuídos os quatro monômeros A, B, C e D rótulos de identificação de acordo com um código binário tal que A = 00, B = 01, C = 10 e D = 11, o substrato codificável contendo a sequência ABC conterá uma etiqueta identificadora que lê 000110.

Será apreciado que a etiqueta identificadora "cresce" com o oligômero em crescimento e, portanto, o número de rótulos de identificação únicos, cujos rótulos de identificação identificam exclusivamente eventos de transformação particulares, é ditado pelo número de eventos de transformação usados ​​para gerar a biblioteca de oligômeros. Consequentemente, uma etiqueta de identificação única é gerada para cada oligômero na biblioteca pela adição sequencial de rótulos de identificação que identificam os eventos de transformação usados ​​para construir o membro da biblioteca.

Como será prontamente apreciado por aqueles versados ​​na técnica, o método de montagem de oligômeros a partir de uma série gradual ou combinada de eventos de transformação pode utilizar qualquer meio químico, físico, enzimático ou biológico, ou combinações dos mesmos, que podem efetuar uma mudança na estrutura de um oligômero ou polímero. Os oligômeros podem ser sintetizados pela introdução, modificação ou remoção de grupos funcionais ou cadeias laterais, abertura e / ou fechamento de anéis, alteração da estereoquímica e semelhantes. Consequentemente, os oligômeros resultantes podem ser lineares, ramificados, cíclicos ou assumir várias outras conformações que serão evidentes para aqueles versados ​​na técnica. Veja as FIGS. 3, 4, 5 e 6.

Além disso, como os substratos são distribuídos entre uma série de vasos de reação, os eventos de transformação usando diferentes químicas físico-químicas, enzimáticas ou biológicas, ou sua combinação, podem ser usados ​​para montar os oligômeros. Exemplos da pletora de eventos de transformação que podem ser usados ​​com a presente invenção são descritos, por exemplo, no pedido de Ser. No. 08 / 180.863 depositado em 13 de janeiro de 1994, que é atribuído ao cessionário da presente invenção e Publicação PCT WO 94/08057 intitulada, "Complex Combinatorial Libraries Encoded with Tags" 14 de abril (1994), cada um dos quais é aqui incorporado por referência.

Assim, os versados ​​na técnica apreciarão que os métodos da presente invenção podem ser usados ​​para sintetizar bibliotecas marcadas de virtualmente qualquer composição química incluindo, mas não se limitando a, amidas, ésteres, tioéteres, cetonas, éteres, sulfóxidos, sulfonamidas, sulfonas , fosfatos, álcoois, aldeídos, alcenos, alcinos, aromáticos, poliaromáticos, compostos heterocíclicos contendo um ou mais dos átomos de: nitrogênio, enxofre, oxigênio e fósforo, e entidades químicas semelhantes com uma estrutura central comum, como, por exemplo , terpenos, esteróides, β-lactamas, benzodiazepinas, xantatos, indóis, indolonas, lactonas, lactamas, hidantoínas, quinonas, hidroquinonas e cadeias semelhantes de unidades monoméricas repetidas, como polissacarídeos, fosfolipídeos, poliuretanos, poliésteres, policarbonatos, poliureias, poliamidas, polietilenoiminas, sulfuretos de poliarileno, poliimidas, poliacetatos, polipeptídeos, polinucleotídeos e semelhantes ou outros oligômeros ou polímeros como serão prontamente evidente para aqueles versados ​​na técnica.

Em uma modalidade preferida, pelo menos um evento de transformação na geração de uma biblioteca de oligômero sintético marcado é a adição enzimática ou química em etapas ou combinada de um ou uma pluralidade de monômeros.

Em outra modalidade preferida, cada evento de transformação na geração de uma biblioteca de oligômero sintético marcado é a adição enzimática ou química em etapas ou combinada de um ou uma pluralidade de monômeros.

Nestes modos preferidos, as funcionalidades que conectam monômeros não precisam ser idênticas. Assim, os polímeros compostos por interligações não idênticas são contemplados pelas formas de realização preferidas. Também são contemplados os oligômeros que são compostos por uma composição de monômero não uniforme. Como um exemplo, um oligômero pode ser composto de aril ou alquil hidroxil, aril ou ácido alquil carboxílico e monômeros de aril ou alquilamina. Como outro exemplo, um oligômero pode ser composto de desoxirribonucleosídeo, carboidrato e unidades de monômero de aminoácido.

Embora tipicamente a presente invenção utilize estratégias de síntese em fase sólida, a presente invenção também contempla químicas em fase de solução. As técnicas para a síntese de péptidos em fase sólida são descritas, por exemplo, em Atherton e Sheppard, Solid Phase Peptide Synthesis: A Practical Approach, IRL Press em Oxford University Press, Oxford, England (1989) para oligonucleótidos em, por exemplo, Gait, Oligonucleotide Synthesis: A Practical Approach, IRL Press em Oxford University Press, Oxford, England (1984), cada um dos quais é aqui incorporado por referência.

Técnicas para soluções e estratégias de síntese de matriz combinatória de múltiplos componentes em fase sólida incluem o pedido de patente U.S. Ser. No. 08 / 092.862 depositado em 13 de janeiro de 1994, que é atribuído ao cessionário da presente invenção, e que é aqui incorporado por referência.

Outras estratégias sintéticas que podem ser empregues pela presente invenção são descritas em, por exemplo, Bunin et al., "The Combinatorial Synthesis and Chemical and Biological Evaluation of a 1,4-Benzodiazepine Library," Proc. Natl. Acad. Sci. 91: 4708-12 (1994) e Patente US No. 5.288.514, intitulada "Solid Phase and Combinatorial Synthesis of Benzodiazepine Compounds on a Solid Support", emitida em 22 de fevereiro de 1994 e Chen et al., "Analogous` Organic Synthesis of Compound Libraries: Validation of Combinatorial Chemistry in Small-Molecule Synthesis, "J. Am. Chem. Chem. Soc. 116: 2661-2662 (1994).

Assim, como aqueles versados ​​na técnica apreciarão, os métodos da presente invenção podem ser usados ​​com virtualmente qualquer estratégia de síntese, seja ela química, biológica ou outra, que agora é conhecida ou será desenvolvida posteriormente, para gerar bibliotecas de oligômeros ou polímeros.

A representação de cada membro da biblioteca dentro da biblioteca depende da distribuição dos substratos nos vasos de reação apropriados em cada ciclo de reação na série de síntese. Em uma modalidade, os substratos podem ser agrupados em cada etapa, misturados e reatribuídos estocasticamente em vasos de reação para ciclos de reação subsequentes. Para mistura e distribuição estocástica, aumentar o número de substratos sobre os quais uma única sequência de oligômero será sintetizada aumenta a probabilidade de que cada sequência de oligômero seja representada na biblioteca.

Em uma modalidade preferida, os substratos são distribuídos de uma maneira não estocástica em cada ciclo de reação. A distribuição não estocástica tem duas vantagens distintas. Primeiro, ele garante que cada sequência de oligômero seja representada na biblioteca de síntese, mesmo se apenas um único substrato for empregado para cada sequência de oligômero. Em segundo lugar, aumenta a probabilidade de que todas as sequências de oligômero sejam representadas em quantidades substancialmente iguais em uma biblioteca sintetizada.

O processo de redistribuição não estocástica em cada ciclo de reação será ditado pela composição da biblioteca. Geralmente, a composição de qualquer biblioteca pode ser descrita como uma série de cálculos matriciais sequenciais. O número de eventos de transformação diferentes em cada ciclo de síntese é representado por uma matriz horizontal de "entrada química". A composição da biblioteca no início de cada ciclo é definida por uma "matriz da biblioteca". A composição da biblioteca na conclusão de qualquer ciclo é o produto da matriz da biblioteca (desde o início do ciclo) e a matriz de entrada química para o ciclo recém-concluído.

A notação da matriz pode ser melhor ilustrada por meio de um exemplo específico. Se alguém deseja construir o conjunto completo de trímeros de oligômero linear composto por quatro entradas de monômero diferentes A, B, C e D (4 3 = 64 membros da biblioteca), a matriz de entrada química em cada ciclo é A, B, C, D ! Assim, no final da primeira etapa de adição de monômero, a matriz da biblioteca é a matriz vertical ## EQU1 ## onde o subscrito denota o número do ciclo de reação na série de ciclos de reação de síntese.

A composição da biblioteca após a segunda rodada de eventos de transformação (aqui reações de adição de monômero) é obtida tomando o produto da matriz de entrada química para o ciclo dois e a matriz da biblioteca do ciclo um. Aqui, a composição da biblioteca no final do segundo ciclo de reação é dada por: ## EQU2 ##

A composição do conjunto completo de trímeros (ou seja, no final do terceiro ciclo de reação) é dada por: ## EQU3 ##

Esta notação de matriz ilustra o processo de redistribuição que deve ocorrer em cada ciclo de reação para gerar uma biblioteca de uma composição particular. Especificamente, em cada ciclo de reação, cada conjunto de substratos em um recipiente de reação particular deve ser dividido em subconjuntos, onde o número de subconjuntos é igual ao número de eventos de transformação diferentes naquele ciclo. O processo de distribuição exato dependerá da composição da biblioteca e será prontamente aparente para aqueles versados ​​na técnica após a revisão desta divulgação.

Em uma modalidade preferida, os substratos podem ser separados manualmente e reatribuídos em cada ciclo de reação. Isso pode ser ilustrado por meio de exemplo específico para uma biblioteca que compreende o conjunto completo de oligômeros N Xn compostos por Xn entradas de monômero montadas em ciclos de reação N. Para a primeira reação de adição de monômero N substratos Xn são divididos em Xn vasos de reação, N Xn / Xn substratos por vaso. Também podem ser usados ​​múltiplos inteiros de substratos N Xn. Após a adição das primeiras entradas de monômero X1, X2,. . . Xn, os substratos em cada um dos Xn os navios são divididos em Xn alíquotas e reatribuídas no Xn vasos, uma alíquota por vaso. Após o segundo ciclo de reação, cada membro da biblioteca pode ser representado como NXn1 Xn2, onde Xn1 representa o primeiro monômero adicionado ao substrato e Xn2 representa o segundo monômero adicionado ao substrato.

Para a terceira etapa de adição de monômero, cada subconjunto de substratos NXn1 Xn2 é dividido em Xn alíquotas e reatribuídas no Xn vasos de reação, uma alíquota por vaso. Repetir este processo N vezes gera o conjunto completo de oligômeros composto por Xn entradas de monômero.

Modificações desta abordagem exemplar também são possíveis. Por exemplo, pode-se usar qualquer série de eventos de transformação em qualquer ciclo de reação. O conjunto de eventos de transformação pode ser expandido ou contraído de ciclo para ciclo ou o conjunto de eventos de transformação pode ser alterado completamente para o próximo ciclo (por exemplo, acoplar um monômero em um ciclo, reorganizar a estereoquímica em outro ciclo). Além disso, pode-se fixar certos eventos de transformação em alguns ciclos enquanto varia outros eventos de transformação, para construir estruturas de oligômero em que certos resíduos ou regiões dentro de oligômeros são alterados para fornecer diversidade.

Noutra forma de realiza�o preferida, os substratos s� separados e redistribu�os em cada ciclo utilizando equipamento de separa�o automatizado. Os substratos são colocados em uma tremonha mecânica que os introduz em um aparelho classificador vibratório, como os comumente empregados na indústria de manufatura para classificar pequenos objetos. O classificador vibratório introduz os substratos um de cada vez em uma rampa de entrega. Anexado ao chute está um detector que pode escanear a etiqueta identificadora e receber um código identificador único. Quando o código é recebido, o substrato é liberado do chute e cai em um vaso de reação. Um sistema de transporte pode ser usado para posicionar um de uma série de vasos de reação sob a rampa de classificação para o recebimento do substrato. Depois que a etiqueta identificadora foi lida, o sistema de transporte pode então ser posicionado de modo que o vaso de reação correto seja posicionado sob a rampa para classificar individualmente ou em grupos, conforme desejado.

III. Identificando a sequência de qualquer oligômero

A presente invenção fornece métodos para identificar a estrutura de qualquer um dos oligômeros na biblioteca. Ao rastrear a via de síntese que cada oligômero tomou, pode-se deduzir a sequência de qualquer oligômero em uma determinada biblioteca. O método envolve a ligação de uma etiqueta identificadora a um oligômero que indica a série de eventos de transformação e os ciclos de síntese correspondentes nos quais esses eventos de transformação foram experimentados, que um oligômero experimentou durante a construção de uma biblioteca de oligômeros sintéticos rotulados. Em uma modalidade, após uma série de ciclos de síntese e detecções de etiqueta identificadora simultânea, rastreia-se os eventos de transformação aos quais uma etiqueta identificadora particular, e, portanto, oligômero, foi submetida em cada ciclo de síntese para determinar a estrutura do oligômero. Em outra modalidade, após uma série de ciclos sintéticos e adições simultâneas de etiqueta identificadora, "lê-se" a etiqueta identificadora associada a um oligômero para determinar a estrutura do oligômero particular.

As tags identificadoras, portanto, identificam cada evento de transformação que um membro da biblioteca de oligômeros individual experimentou. Além disso, é gerado um registro do ciclo de síntese na série de síntese em que cada evento de transformação foi experimentado ("histograma de reação"). Conforme descrito acima, as tags de identificador podem ser pré-codificadas com informações de identificador exclusivo antes da síntese ou podem ser codificadas com informações imediatamente antes, durante ou após cada evento de transformação. Os métodos que empregam etiquetas identificadoras pré-codificadas e, portanto, em que uma etiqueta identificadora única é atribuída a cada membro da biblioteca antes da síntese, requerem um número de etiquetas identificadoras exclusivas igual ao número de membros da biblioteca. Os métodos que empregam tags de identificador codificáveis ​​e em que as informações do identificador são adicionadas em cada evento de transformação requerem apenas tantos rótulos de identificação exclusivos, que os rótulos identificam exclusivamente eventos de transformação particulares, como há diferentes eventos de transformação no ciclo de síntese. Marcas identificadoras únicas que identificam a estrutura de cada oligômero na biblioteca são geradas concomitantemente com a síntese à medida que rótulos de identificação que identificam cada evento de transformação são adicionados, de preferência de uma forma sequencial, às marcas identificadoras codificáveis ​​em cada ciclo de síntese. Nesta última modalidade, as etiquetas identificadoras preservam um registro sequencial de quais eventos de transformação particulares um substrato experimentou em cada ciclo de síntese.

4. Tipos de etiquetas identificadoras

Os identificadores da presente invenção podem ser qualquer característica detectável que permite a elucidação da estrutura de cada oligômero sintetizado em uma dada biblioteca marcada. Assim, as etiquetas identificadoras podem ser, por exemplo: microscopicamente distinguíveis em forma, tamanho, cor, densidade óptica, etc. diferencialmente absorvendo ou emitindo luz quimicamente reativa pré-codificada com informação óptica, magnética ou eletrônica ou de alguma outra forma distintamente marcada com as informações decifráveis ​​necessárias.

Numa forma de realização preferida da invenção, as etiquetas identificadoras referem informações de volta a um detector quando pulsadas com radiação eletromagnética.

Em uma modalidade mais preferida, as etiquetas identificadoras são microchips que são pré-codificados ou codificáveis ​​com uma "impressão digital" de radiofrequência única que pode ser detectada pulsando a etiqueta identificadora com radiação eletromagnética.

A impressão digital de radiofrequência pode ser uma única banda de radiofrequência ou uma combinação de bandas de radiofrequência. Quando pulsadas com radiação eletromagnética, as etiquetas identificadoras emitem uma impressão digital de radiofrequência que é detectada por um detector de radiação eletromagnética. Portanto, pode ser apreciado que o número de etiquetas identificadoras de radiofrequência únicas, ou "impressões digitais", que estão disponíveis é virtualmente ilimitado.

As etiquetas identificadoras da presente invenção podem ser pré-codificadas com informações identificadoras únicas antes da síntese de uma biblioteca de oligômeros sintéticos marcados. Por exemplo, uma etiqueta identificadora pode ser uma tira de código de barras que corresponde, digamos, ao número 001, ou pode ser uma impressão digital de radiofrequência composta por uma ou uma pluralidade de bandas de frequência. Cada membro da biblioteca é, portanto, rotulado com uma etiqueta identificadora estática única em toda a síntese combinatória, ou de uma forma "do nascimento à morte".

As tags identificadoras também podem ser codificadas com novas informações de tempos em tempos. Por exemplo, a etiqueta identificadora pode ser uma tira de código de barras que pode receber informações sequenciais de tempos em tempos ou um microchip que pode ser "baixado" com informações digitais de tempos em tempos. As etiquetas de identificação codificáveis ​​podem ser em branco ou pré-codificadas com informações de identificador parcial ou completa antes da síntese de uma biblioteca de oligômero sintético marcado.

Cada evento de transformação em uma série de ciclos de reação na síntese de uma biblioteca de oligômeros sintéticos rotulados é atribuído a um rótulo de identificação exclusivo, cujo rótulo é adicionado à etiqueta de identificador codificável, seja concomitante ou próximo ao desempenho de um evento de transformação específico . No término de uma síntese que compreende um número ilimitado de ciclos de reação e eventos de transformação, um sinal sequencial único foi baixado para o microchip de modo que o histórico de eventos de transformação aos quais o substrato codificável foi submetido seja registrado de forma sequencial no microchip . A sequência de oligômero pode, portanto, ser deduzida pela detecção da informação de identificação sequencial única contida na etiqueta identificadora.

Noutra forma de realização preferida, as etiquetas identificadoras da presente invenção são encerradas num vidro ou material polimérico. Tal vidro ou material polimérico pode ser prontamente ligado a suportes de síntese, diretamente derivatizado com um ou uma pluralidade de grupos funcionais adequados para a síntese, ou diretamente derivatizado com um ou uma pluralidade de ligantes contendo um ou uma pluralidade de grupos funcionais adequados para a síntese. Pode ser prontamente apreciado que a identidade de tais grupos funcionais será ditada pela composição dos oligômeros desejados. Os grupos adequados serão facilmente evidentes para os especialistas na técnica e incluem, mas não se restringem a, amino, carboxilo, sulfidrilo, hidroxilo e semelhantes.

Qualquer vidro ou material polimérico capaz de envolver uma etiqueta identificadora pode ser usado na presente invenção. Em um modo, esse material polimérico é capaz de ser derivatizado com um ou uma pluralidade de grupos funcionais ou ligantes adequados para a síntese. Polímeros como polietilenoglicol poliestireno-divinil benzeno, poliestireno enxertado com polietileno, compósitos de poliacrilamida-diatomácea e vidro foram todos comercializados com grupos funcionais adequados para derivatização com vários ligantes e monômeros. Métodos para derivatizar tais polímeros são bem conhecidos na técnica. Ver, por exemplo, Atherton e Sheppard, Solid Phase Peptide Synthesis: A Practical Approach, IRL Press at Oxford University Press, Oxford, England (1989), e Gait, Oligonucleotide Synthesis: A Practical Approach, IRL Press at Oxford University Press, Oxford, England (1984), cada um dos quais é aqui incorporado por referência.

As etiquetas de identificação preferidas adequadas são bem conhecidas na técnica e são descritas, por exemplo, na Pat. No. 5.252.962, intitulada "System Monitoring Programmable Implantable Transponder," emitida em 12 de outubro de 1993, para Bio Medic Data Systems, Inc. e Pat. No. 5.351.052, intitulada "Transponder System for Automatic Identification Purposes", emitida em 27 de setembro de 1994, para Texas Instruments, Inc., cada uma das quais é aqui incorporada por referência. Os exemplos comercialmente disponíveis incluem ELAMS ™ (Electronic Laboratory Animal Monitoring Systems), fabricado pela Biomedic Data Systems, 225 West Spring Valley Ave., Maywood, NJ 07607, e TIRIS ™ (Texas Instruments Registration and Identification System), fabricado pela Texas Instruments, 12501 Research Blvd., Mailstop 2243, Austin, Tex. 78759.

ELAMS ™, que são amplamente usados ​​para marcar e identificar ratos de laboratório por meio de injeção subcutânea do ELAM ™, compreendem microchips revestidos de vidro que são pré-sintonizados para emitir uma impressão digital de radiofrequência exclusiva quando pulsados ​​com radiação eletromagnética. O TIRIS ™, que atualmente é usado para cartões de segurança e para rastrear e identificar gado e automóveis, compreende microchips envoltos em vidro que podem ser baixados com informações digitais de tempos em tempos.

ELAMS ™ e TIRIS ™ possuem uma variedade de recursos que os tornam ideais para uso como etiquetas identificadoras de biblioteca de química combinatória. Por exemplo, ELAMS ™ e TIRIS ™ podem ser prontamente classificados usando a tecnologia de classificação automática disponível atualmente. Além disso, as informações codificadas podem ser escaneadas e armazenadas em um microcomputador. Além disso, ELAMS ™ e TIRIS ™ são compatíveis com virtualmente qualquer química agora conhecida ou que será desenvolvida posteriormente para gerar bibliotecas de oligômeros ou polímeros. Assim, grandes bibliotecas rotuladas de virtualmente qualquer composição química podem ser geradas de forma automatizada, aumentando assim a diversidade de bibliotecas rotuladas disponíveis enquanto diminui o tempo e o esforço necessários para gerar tais bibliotecas.

V. Vinculando os oligômeros às tags identificadoras

Um oligômero da presente invenção pode ser ligado a uma etiqueta identificadora em uma variedade de formas. Veja, por exemplo, a FIG. 7. Um ou uma pluralidade de oligômeros de sequência idêntica pode ser anexado diretamente a um ou uma pluralidade de grupos funcionais em uma etiqueta identificadora, a um ou uma pluralidade de ligantes que estão anexados a uma etiqueta identificadora, ou a um ou uma pluralidade de Suportes de síntese que são anexados a uma etiqueta identificadora. Uma etiqueta identificadora também pode ser retida dentro de uma estrutura ou alojamento ao qual um ou uma pluralidade de oligômeros de estrutura idêntica são fixados. Além disso, uma etiqueta identificadora pode ser retida dentro de uma estrutura ou alojamento que também retém um ou uma pluralidade de suportes de síntese ligados a ela um ou uma pluralidade de oligômeros de estrutura idêntica.

Em uma modalidade preferida, um ou uma pluralidade de oligômeros de estrutura idêntica são fixados diretamente a um ou uma pluralidade de grupos funcionais em uma etiqueta identificadora. Normalmente, a etiqueta identificadora será encerrada em um vidro ou material polimérico que pode ser derivatizado com um ou uma pluralidade de grupos funcionais adequados para a síntese. Qualquer material polimérico capaz de fornecer grupos funcionais adequados para fixação pode ser utilizado. Pode ser facilmente apreciado que a identidade dos grupos funcionais será ditada pela composição dos oligômeros desejados. Os grupos adequados serão facilmente evidentes para os especialistas na técnica e incluem, mas não estão limitados a, amino sulfidrila, hidroxila e semelhantes.

Vários materiais poliméricos têm sido comercializados com grupos funcionais adequados, tais como, por exemplo, poliestireno-divinilbenzeno, poliestireno enxertado com polietileno, compósito de poliacrilamida kieselguhr e vidro de poro controlado. Os métodos para derivatizar tais polímeros são bem conhecidos na técnica. Ver, por exemplo, Atherton e Sheppard, Solid Phase Peptide Synthesis: A Practical Approach, IRL Press at Oxford University Press, Oxford, England (1989), and Gait, Oligonucleotide Synthesis: A Practical Approach, IRL Press at Oxford University Press, Oxford, England (1984), cada um dos quais é aqui incorporado por referência.

Alternativamente, um ou uma pluralidade de oligômeros de estrutura idêntica pode ser anexado aos grupos funcionais em uma etiqueta identificadora por meio de um ligante. Um ligante é geralmente uma porção, molécula ou grupo de moléculas ligadas a um suporte de síntese ou substrato e espaçamento de um polímero ou oligômero sintetizado de um suporte de síntese ou substrato.

Normalmente, um ligante será bi-funcional, em que o referido ligante tem um grupo funcional em uma extremidade capaz de se ligar a um monômero, oligômero, suporte de síntese ou substrato, uma série de resíduos espaçadores e um grupo funcional em outra extremidade capaz de se ligar a um monômero, oligômero, suporte de síntese ou substrato.

Os grupos funcionais de um linker bifuncional não precisam ser idênticos, permitindo assim que o linker atue como um "adaptador de grupo funcional". Assim, os ligantes bifuncionais fornecem um meio pelo qual o grupo funcional exibido em um substrato ou suporte de síntese, digamos um grupo amino, pode ser convertido em um grupo funcional diferente, digamos um grupo hidroxila. O uso de ligantes bifuncionais pode, portanto, aumentar muito o repertório de produtos químicos que podem tirar vantagem das estratégias de síntese em fase sólida.

A composição e o comprimento do ligante dependerão em grande parte da aplicação da biblioteca. O grau de ligação entre um membro da biblioteca imobilizado e seu parceiro de ligação pode, em algumas modalidades, depender da acessibilidade do membro da biblioteca imobilizado ao seu parceiro de ligação. A acessibilidade, por sua vez, pode depender do comprimento e / ou composição química da fração de ligação.

A composição da porção ligante também dependerá das propriedades desejadas do ligante e, em grande parte, será ditada pelas condições físicas e / ou reagentes biológicos ou químicos aos quais o ligante será exposto durante a síntese. Por exemplo, pode-se desejar um ligante rígido, como por exemplo, poli-prolina ou poli-alil, ou pode-se desejar um ligante flexível, como, por exemplo, polialanina ou hidrocarbonetos saturados.

É desejável que o ligante seja estável às condições de reação usadas para construir a biblioteca. Os ligantes de composições adequadas serão facilmente evidentes para os especialistas na técnica ou podem ser desenvolvidos posteriormente.

O número de resíduos espaçadores que compreendem o ligante também pode variar. Normalmente, um ligante compreenderá geralmente cerca de 1-100 resíduos espaçadores, de preferência cerca de 1-20 resíduos espaçadores, e geralmente cerca de 5-15 resíduos espaçadores.

Os resíduos espaçadores podem ser átomos capazes de formar pelo menos duas ligações covalentes, como carbono, silício, oxigênio, nitrogênio, enxofre, fósforo e semelhantes. Os resíduos espaçadores também podem ser moléculas capazes de formar pelo menos duas ligações covalentes, tais como aminoácidos, nucleosídeos, nucleotídeos, açúcares, anéis aromáticos, anéis de hidrocarbonetos, carboidratos, hidrocarbonetos ramificados ou lineares e semelhantes. Assim, as interligações que compreendem o ligante incluem, mas não estão limitadas a, amidas, éteres, ésteres, ureias, fosfoésteres, tioésteres, tioéteres e semelhantes. As interligações que conectam os resíduos espaçadores podem ser, mas não precisam ser, idênticas.

Ligados entre si, os resíduos espaçadores podem formar estruturas lineares, cíclicas, ramificadas ou outros tipos. Assim, um ligante pode fornecer uma pluralidade de grupos funcionais aos quais os oligômeros podem ser ligados, aumentando assim a quantidade de oligômero sintetizado. Ligados uns aos outros, os resíduos espaçadores podem ser rígidos, semirrígidos ou flexíveis. Os resíduos espaçadores que compreendem o ligante podem ser, mas não precisam ser, idênticos.

Essas porções de ligação podem ser capazes de liberar posteriormente as moléculas sintetizadas por algum mecanismo regulável específico. Tais mecanismos reguláveis ​​incluem, mas não estão restritos a reações térmicas, fotoquímicas, eletroquímicas, ácidas, básicas, oxidativas e redutivas. Vários ligantes que fornecem uma variedade de estratégias de acoplamento e clivagem de grupos funcionais estão disponíveis comercialmente.

Como será prontamente aparente para o versado na técnica após a revisão desta divulgação, os métodos e aparelhos de síntese combinatória marcados descritos neste documento podem ser usados ​​para otimizar a composição e o comprimento do ligante.

Em outra modalidade preferida, um ou uma pluralidade de oligômeros de estrutura idêntica podem ser fixados a um ou uma pluralidade de suportes de síntese que são fixados a uma etiqueta identificadora. Um oligômero pode ser covalentemente ligado diretamente a um grupo funcional no suporte de síntese, ou pode ser ligado a um suporte de síntese por meio de um ligante como descrito acima. Em uma modalidade preferida, um ou uma pluralidade de suportes de síntese são fixados a uma etiqueta identificadora por meios físicos, como cola ou atração magnética. Praticamente qualquer meio físico que seja estável às condições de reação empregadas para sintetizar a biblioteca pode ser usado.

Em outra modalidade preferida, um ou uma pluralidade de suportes de síntese é covalentemente anexado a uma etiqueta identificadora (opcionalmente envolvida em um vidro ou revestimento polimérico).Tal ligação covalente pode ser diretamente a um ou a uma pluralidade de grupos funcionais na etiqueta identificadora, ou por meio de um ligante como descrito acima.

Em ainda outra modalidade preferida, uma etiqueta identificadora pode ser retida dentro de uma estrutura ou alojamento, cujo quadro ou alojamento também retém um ou uma pluralidade de oligômeros de estrutura idêntica ou um ou uma pluralidade de suportes de síntese tendo anexado a ele um ou uma pluralidade de oligômeros de estrutura idêntica. Tal ligação de oligômero pode ser diretamente a um grupo funcional no suporte de síntese ou pode ser mediada por um ligante como descrito acima.

Ainda noutra forma de realiza�o preferida, uma etiqueta identificadora pode ser retida numa estrutura ou inv�ucro, quadro ou inv�ucro esse que se anexou a um ou uma pluralidade de olig�eros de estrutura id�tica. Tal fixação de oligômero pode ser diretamente a um grupo funcional na estrutura ou alojamento, ou pode ser mediada por um ligante como descrito acima.

VI. Codificando as informações da etiqueta identificadora

Uma variedade de tipos de informação pode ser codificada nas etiquetas de identificação da presente invenção. Por exemplo, as etiquetas identificadoras podem ser pré-codificadas com uma tira de código de barras, porções que absorvem ou emitem luz diferencialmente, informações magnéticas ou ópticas ou qualquer outra marca identificável e detectável de forma única. Assim, os meios empregados para codificar a informação da etiqueta identificadora são ditados pelos meios empregados para detectar o sinal de identificação codificado.

Em uma modalidade preferida, uma etiqueta identificadora compreende um microchip que é impresso com uma "impressão digital" de radiofrequência única que é transmitida de volta a um detector quando a etiqueta identificadora é pulsada com radiação eletromagnética. Nesta modalidade, um microchip é exposto a um feixe que compreende uma ou uma pluralidade de bandas de radiofrequência. O microchip extrai energia do feixe. O microchip possui uma impressão digital eletrônica. Assim, microchips de diferentes impressões digitais emitirão diferentes sinais quando pulsados ​​com radiação eletromagnética. Consequentemente, cada um de uma pluralidade de microchips pode ser pré-codificado com uma "impressão digital" única ou etiqueta de identificação. O perito na arte apreciará que o número de microchips que podem ser impressos com uma etiqueta de identificação única é virtualmente ilimitado. Esses microchips são bem conhecidos na técnica e são descritos, por exemplo, nas Patentes U.S. No. 5.148.404, intitulada "Transponder e Método para a Produção deste", emitida em 15 de setembro de 1992, para Texas Instruments, Inc., e que é aqui incorporada por referência.

Em outra modalidade preferida, uma etiqueta identificadora compreende um microchip que pode ser impresso com informação digital ou sequencial em cada ciclo de reação em uma série de ciclos de reação. A etiqueta identificadora pode ser pré-codificada com informação de identificador parcial ou completa ou em branco antes da síntese de uma biblioteca de oligômero sintético marcada. Concomitante com, ou em um ponto próximo a cada ciclo de reação, um novo multi-dígito identificando o evento de transformação que um substrato codificável específico experimentou é baixado para a tag identificadora de modo que um histórico de eventos de transformação aos quais a tag identificadora foi submetida está gravado. Uma vez que a informação do identificador em cada ciclo é adicionada sequencialmente ao microchip, cada estrutura de oligômero pode ser elucidada pela detecção da informação digital sequencial contida na etiqueta identificadora ligada a esse oligômero particular. Substratos codificáveis ​​digitalmente adequados e métodos de codificação são bem conhecidos ou serão evidentes para os versados ​​na técnica e são descritos, por exemplo, nas Patentes US No. 5.351.052, intitulada "Transponder Systems for Automatic Identification Purposes," emitida em 27 de setembro de 1994 para Texas Instruments, Inc. e Pat. No. 5.252.962, intitulada "System Monitoring Programmable Implantable Transponder," emitida em 12 de outubro de 1993, para Bio Medic Data Systems, Inc., cada uma das quais é aqui incorporada por referência.

VII. Recuperando e decodificando as informações da etiqueta identificadora

Quando membros específicos da biblioteca são isolados em um experimento de triagem de receptor, os substratos podem ser segregados individualmente por uma série de meios, incluindo: micromanipulação, atração magnética, classificação ou classificação de células ativadas por fluorescência (FACS), embora em relação à presente invenção FACS é mais precisamente "classificação de oligômero ativado por fluorescência". Ver Methods in Cell Biology, Vol. 33, Darzynkiewicz, Z. e Crissman, H. A. eds., Academic Press e Dangl e Herzenberg, J. Immunol. Methods 52: 1-14 (1982), ambos aqui incorporados por referência.

Uma vez que os substratos desejados foram isolados, a identidade da etiqueta identificadora deve ser verificada para obter a estrutura do oligômero no substrato. O método de identificação dependerá do tipo de etiqueta identificadora usada para codificar a biblioteca. Por exemplo, etiquetas identificadoras de código de barras podem ser lidas com dispositivos a laser comumente empregados na arte para ler códigos de barras. As etiquetas identificadoras fluorescentes podem ser lidas através da obtenção de um espectro de fluorescência.

Em modalidades preferidas que empregam etiquetas identificadoras de microchip, as informações da etiqueta identificadora podem ser lidas usando dispositivos de detecção comumente empregados na técnica para digitalizar e armazenar informações identificadoras de tais etiquetas. Normalmente, esses detectores podem varrer, exibir, transmitir e armazenar informações do identificador recebidas de uma etiqueta identificadora. Tais detectores são bem conhecidos na técnica e são descritos, por exemplo, na Patente US No. 5.262.772, intitulada "Transponder Scanner" emitida em 16 de novembro de 1993, para Bio Medic Data Systems, Inc., que é aqui incorporada por referência. Esses sistemas que leem, exibem, transmitem e armazenam informações de identificador e que podem ser conectados a um microcomputador estão disponíveis comercialmente, incluindo os modelos de Bio Medic Data Systems DAS-4004EM, DAS-40020A e DAS-4001.

Em modalidades preferidas, o sistema de detecção empregado será conectado a um computador para automatizar o armazenamento de informações da etiqueta identificadora. Em modalidades ainda mais preferidas, o equipamento de detecção será conectado a um computador e a um equipamento de triagem automatizado.

VIII. Seleção de receptores com bibliotecas de oligômeros sintéticos marcados

As bibliotecas de oligômeros sintéticos marcados da presente invenção terão uma ampla variedade de utilizações. A título de exemplo e não de limitação, bibliotecas de oligômeros sintéticos marcados podem ser usadas para identificar peptídeos, ácidos nucleicos, carboidratos e / ou outras estruturas que se ligam a proteínas, enzimas, anticorpos, receptores e semelhantes identificar drogas de ligação específicas de sequência identificar epítopos reconhecidos por anticorpos avaliar uma variedade de drogas para aplicações de diagnóstico clínico identificar materiais que exibem propriedades específicas, tais como, por exemplo, elementos de identificação de cerâmica compreendendo combinações de composições supercondutoras dos anteriores e outros usos que serão evidentes para aqueles versados ​​na técnica.

Os oligômeros sintéticos exibidos em substratos podem ser rastreados quanto à capacidade de se ligarem a um receptor. O receptor pode ser colocado em contato com a biblioteca de oligômeros sintéticos, formando um membro ligado entre um receptor e o oligômero capaz de se ligar ao receptor. O membro ligado pode então ser identificado. Como um exemplo, o receptor pode ser um anticorpo.

As técnicas para seleção de substratos individuais exibindo ligantes em sua superfície são análogas aos métodos FACS para clonagem de células de mamíferos que expressam antígenos e receptores de superfície celular. Portanto, os métodos para selecionar e classificar substratos serão prontamente aparentes para aqueles versados ​​na técnica de classificação de células. Por exemplo, um receptor pode ser marcado com uma etiqueta fluorescente e então incubado com a mistura de substratos exibindo os oligômeros. Depois de lavar os receptores não ligados e não especificamente ligados, pode-se então usar FACS para classificar as contas e identificar e isolar contas fisicamente individuais que mostram alta fluorescência. Alternativamente, se o tamanho físico dos substratos permitir, pode-se identificar e classificar manualmente os substratos que apresentam alta fluorescência.

Alternativamente, a presente invenção pode ser usada para gerar bibliotecas de oligômeros marcados solúveis, que podem ser usados ​​com uma variedade de métodos de rastreio. Por exemplo, os substratos podem ser classificados e colocados em compartimentos ou poços individuais, como, por exemplo, os poços de uma placa de microtitulação de 96 poços. Os oligômeros são clivados dos substratos e permaneceram contidos dentro do poço junto com a etiqueta identificadora. Os membros da biblioteca podem então ser ensaiados em solução por uma variedade de técnicas que serão prontamente aparentes para aqueles versados ​​na técnica de imunologia, um exemplo das quais é descrito abaixo.

Em uma modalidade, a superfície inferior de cada poço é revestida com o receptor. Após a adição do tampão de ligação e um ligando conhecido para esse receptor que é marcado com fluorescência, tem-se efetivamente um ensaio competitivo de fase de solução para novos ligantes do receptor. A ligação do ligando marcado com fluorescência ao receptor é estimada por imagem confocal da monocamada do receptor imobilizado. Os poços que mostram fluorescência diminuída na superfície do receptor indicam que o oligômero liberado compete com o ligante marcado. Os substratos nos poços que mostram competição são recuperados e a etiqueta identificadora decodificada para revelar a sequência do oligômero.

SÍNTESE DE CEM AMIDAS

Cem identificadores exclusivos contendo polímero Rink são subdivididos em dez grupos de dez, e cada grupo de dez é introduzido em um recipiente de reação separado de 250 mL carregado com 100 mL de solvente metanol. A cada recipiente de reação são então adicionados 10 mL de uma solução contendo um aldeído dissolvido em metanol, um aldeído diferente adicionado a cada recipiente de reação.

A reação é agitada durante seis horas à temperatura ambiente, ou até a conclusão da reação. A reação pode ser monitorada usando técnicas padrão para o monitoramento de reações em fase sólida. Após a conclusão da reação, o solvente e o excesso de reagentes são removidos de cada um dos dez vasos de reação independentemente, e o polímero em cada vaso é lavado três vezes com metanol e diclorometano e deixado secar sob pressão reduzida.

As etiquetas identificadoras exclusivas são então registradas removendo o conteúdo de cada recipiente de reação e passando a etiqueta identificadora única por um detector. A etiqueta de identificação única para cada oligômero é, portanto, registrada e com referência cruzada ao vaso de reação do qual foi removido.

Os identificadores exclusivos associados ao polímero Rink são então recombinados aleatoriamente e novamente subdivididos em dez grupos de dez, e cada grupo de dez colocados em recipientes de reação diferentes (250 mL) contendo 100 mL de diclorometano. Cada um dos dez vasos de reação é carregado com base e dez cloretos de ácido únicos são introduzidos nos vasos de reação, um cloreto de ácido por vaso.

As reações podem prosseguir até ao fim. As reações podem ser monitoradas usando métodos padrão. Após a conclusão, o solvente é removido por filtração e o oligômero em cada vaso de reação é lavado independentemente com três lavagens de metanol e diclorometano. Cada uma das dez etiquetas identificadoras é então removida de cada vaso e passada por um detector para registrar seus números de identificação únicos.

Assim, cada número de identificação está associado a um reagente específico utilizado na primeira etapa da síntese (um aldeído) e na segunda etapa da síntese (um cloreto de ácido), fornecendo um "histograma de reação" único para cada uma das cem tags de identificador.

Após a conclusão das reações, as etiquetas identificadoras associadas a cada polímero são desbloqueadas separadamente usando ácido trifluoroacético e introduzidas em uma placa de microtitulação de modo que cada poço da placa de microtitulação contenha apenas um único polímero. Após a remoção do solvente e evaporação até a secura, cada poço contém uma estrutura única.

A descodificação da referida estrutura pode ser realizada comparando a etiqueta de identificação individual com o histograma dessa etiqueta em particular. Ou seja, a etiqueta identificadora será associada a uma estrutura específica para a entrada do monômero de aldeído e uma estrutura específica para a entrada do monômero de cloreto de ácido. A estrutura do polímero contido em cada poço é assim conhecida inequivocamente.

SÍNTESE EM ELAMS ™ DE QUATRO PENTAPEPTÍDEOS

A. Derivatização de ELAMS ™

Quatro (ou múltiplos deles) ELAMS ™ (Biomedic Data Systems), cada um com uma etiqueta de identificação única, são lavados com HNO aquoso em refluxo3 por 20 min. Os ELAMS ™ são peletizados e lavados com água destilada (5 ×) e metanol (3 ×) e secos a 125 ° C por cerca de 12 horas. Os ELAMS ™ são então agitados com uma solução de 5% (v / v) aminopropiltrietoxissilano em acetona por dez horas, lavados com acetona (2 ×), etanol (5 ×) e cloreto de metileno (2 ×) e secos a 125 ° C. por 45 min.

Os ELAMS ™ são suspensos em DMF anidro (1 mL) contendo diisopropiletilamina (DIEA) (17 μL, 100 μmoles) e uma solução de Fmoc-b-alanina pentafluorofenil éster (200 mg, 420 μmoles, Peninsula Labs) em água destilada (1,5 mL) adicionado. Após tratamento com agitação durante cerca de 12 horas, o ELAMS ™ pode ser recolhido e lavado com DMF (3 ×) e cloreto de metileno (2 ×). ELAMS ™ são tratados com uma solução de anidrido acético a 10% em DMF contendo 0,05 mol de 4-dimetilaminopiridina para cobrir grupos aminopropil desacoplados e então lavados com DMF (2 ×) e cloreto de metileno (2 ×). ELAMS ™ são então agitados com uma solução de piperidina 20% em DMF para liberar o grupo protetor Fmoc. O aduto Fmoc-piperidina pode ser quantificado monitorando o espectro de absorbância do sobrenadante a 302 nm (ε302 = 7800M -1 cm -1) para estimar o grau de substituição de grupos amino por quantidade de E. Finalmente, os ELAMS ™ são lavados com etanol (5 ×) e cloreto de metileno (2 ×) e secos a 85 ° C durante cerca de 12 horas.

B. Preparação de Boc-Glv-L-Phe-L-Leu-OH

Glicil-L-fenilalanil-L-leucina (552 mg, 1,5 mmol, Bachem) é dissolvida em uma solução contendo água destilada (10 mL) e NaOH 1M (1,5 mL). A solução é resfriada em um banho de gelo e tratada com uma solução de pirocarbonato de di-terc-butila (337 mg, 1,5 mmol) em p-dioxano (12 mL). A solução é agitada durante 4 horas à temperatura ambiente, após o que a solução é concentrada até à secura in vacuo, o resíduo retomado em água (5 mL) e o pH ajustado a 2,5 pela adição de KHSO 1M4. A suspensão aquosa é extraída com acetato de etila (2 x, 15 mL), a camada orgânica separada e seca sobre sulfato de magnésio. Após a remoção do solvente in vacuo, o resíduo pode ser titulado com hexano para produzir Boc-Gly-L-Phe-L-Leu-OH como um sólido branco.

C. Preparação de Glv-L-Phe-L-Leu ELAMS ™

Boc-Gly-L-Phe-L-Leu-OH (44 mg, 0,1 mmol), hexaflurophsophate de benzotriazol-1-iloxitris (dimetilamino) fosfônio (14 mg, 0,104 mmol) são dissolvidos em DMF seco (1 mL). DIEA (20 μL, 0,115 mmol) é adicionado e cerca de 0,5-1,0 mL desta solução é transferida para um tubo de ensaio contendo ELAMS ™ derivatizado com amino. O tubo é selado, agitado em vórtex durante cerca de 3,5-4 horas e o ELAMS ™ sedimentado e lavado com DMF (3 ×) e cloreto de metileno (2 ×). Os ELAMS ™ são então desprotegidos com uma solução de ácido trifluoroacético a 50% (TFA) em cloreto de metileno por 30 min., Lavados com cloreto de metileno (2 ×), etanol (2 ×) e cloreto de metileno (2 ×), e secos em 55 ° C por cerca de 1 hora. A etiqueta identificadora de cada ELAMS ™ é detectada e registrada.

D. Preparação de Gly-Glv-L-Phe-L-Leu (SEQ ID NO: 5) ELAMS ™

Éster pentafluorofenílico de Fmoc-glicina (46 mg, 0,1 mmol) é dissolvido em DMF anidro (1 mL) contendo DIEA (17 μL, 0,1 mmol). Cerca de 0,5-1,0 mL desta solução é adicionado a Gly-L-Phe-L-Leu ELAMS ™ em um tubo de ensaio e o tubo agitado em vórtex por cerca de 3 horas. Os ELAMS ™ são sedimentados e lavados com DMF (4 ×) e cloreto de metileno (2 ×). A desprotecção pode ser efectuada por tratamento com uma solução de piperidina a 20% em DMF durante 30 min. Os ELAMS ™ são então lavados com DMF (2 ×), etanol (2 ×) e cloreto de metileno (2 ×) e secos a 60 ° C durante 4 horas. A etiqueta identificadora para cada ELAMS ™ é detectada e registrada.

E. Preparação de L-Pro-Gly-L-Phe-L-Leu (SEQ ID NO: 6) ELAMS ™

Éster pentafluorofenílico de Fmoc-L-prolina (50 mg, 0,1 mmol) é dissolvido em DMF anidro (1 mL) contendo DIEA (17 μL, 0,1 mmol). Cerca de 0,5-1,0 mL desta solução é adicionado a Gly-L-Phe-L-Leu ELAMS ™ em um tubo de ensaio e o tubo agitado em vórtex por cerca de 3 horas. Os ELAMS ™ são sedimentados e lavados com DMF (4 ×) e cloreto de metileno (2 ×). A desprotecção pode ser efectuada por tratamento com uma solução de piperidina a 20% em DMF durante 30 min. Os ELAMS ™ são então lavados com DMF (2 ×), etanol (2 ×) e cloreto de metileno (2 ×) e secos a 60 ° C durante 4 horas. A etiqueta identificadora para cada ELAMS ™ é detectada e registrada.

F. Preparação de Tyr-Gly-Glv-L-Phe-L-Leu (SEQ ID NO: 1) e Tyr-Pro-Glv-L-Phe-L-Leu (SEQ ID NO: 2) ELAMS ™

Fmoc-O-t-butil-L-tirosina pentafluorofenil éster (63 g, 0,1 mmol) é dissolvido em DMF anidro (1 mL) contendo DIEA (17 μL, 0,1 mmol). Cerca de 0,5-1,0 mL desta solução é adicionado a Gly-Gly-L-Phe-L-Leu (SEQ ID NO: 5) e Pro-Gly-L-Phe-L-Leu (SEQ ID NO: 6) ELAMS ™ em um tubo de ensaio e o tubo agitado em vórtice por cerca de 3 horas. Os ELAMS ™ são sedimentados e lavados com DMF (4 ×) e cloreto de metileno (2 ×). A desprotecção pode ser efectuada por tratamento com uma solução de piperidina a 20% em DMF durante 30 min, seguido de tratamento com uma solução de TFA a 50% em cloreto de metileno durante 30 min. Os ELAMS ™ são então lavados com DMF (2 ×), etanol (2 ×) e cloreto de metileno (2 ×) e secos a 60 ° C durante 4 horas. A etiqueta identificadora para cada ELAMS ™ é detectada e registrada.

G. Preparação de Pro-L-Pro-Glv-L-Phe-L-Leu (SEQ ID NO: 3) e Pro-Gly-Glv-L-Phe-L-Leu (SEQ ID NO: 4) ELAMS ™

Éster pentafluorofenílico de Fmoc-L-prolina (50 mg, 0,1 mmol) é dissolvido em DMF anidro (1 mL) contendo DIEA (17 μL, 0,1 mmol). Cerca de 0,5-1,0 mL desta solução é adicionado a Gly-Gly-L-Phe-L-Leu (SEQ ID NO: 5) e Pro-Gly-L-Phe-L-Leu (SEQ ID NO: 6) ELAMS ™ em um tubo de ensaio e o tubo agitado em vórtice por cerca de 3 horas. Os ELAMS ™ são sedimentados e lavados com DMF (4 ×) e cloreto de metileno (2 ×). A desprotecção pode ser efectuada por tratamento com uma solução de piperidina a 20% em DMF durante 30 min. Os ELAMS ™ são então lavados com DMF (2 ×), etanol (2 ×) e cloreto de metileno (2 ×) e secos a 60 ° C durante 4 horas. A etiqueta identificadora para cada ELAMS ™ é detectada e registrada.

H. Seleção de ligantes peptídicos contendo ELAMS ™ para o anticorpo monoclonal 3E7

O anticorpo monoclonal 3E7 pode ser criado contra o peptídeo opióide beta-endorfina.A especificidade de ligação do MAb 3E7 foi bem caracterizada por ensaios de solução com péptidos sintetizados quimicamente. As constantes de ligação de equilíbrio (Kd) dos peptídeos considerados aqui são as seguintes: YGGFL (SEQ ID NO: 1) é 6,6 nM e YPGFL (SEQ ID NO: 2), PPGFL (SEQ ID NO: 3) e PGGFL (SEQ ID NO: 4) são cada um & gt1 mM, portanto, apenas o peptídeo YGGFL (SEQ ID NO: 1) mostra afinidade apreciável para o anticorpo.

Uma mistura de ELAMS ™ contendo YGGFL (SEQ ID NO: 1), YPGFL (SEQ ID NO: 2), PGGFL (SEQ ID NO: 4) ou PPGFL (SEQ ID NO: 3) são adicionados a solução salina tamponada com fosfato ( PBS) contendo anticorpo monoclonal 3E7 que foi previamente conjugado a microesferas coloidais superparamagnéticas (Miltenyi Biotec, Alemanha Ocidental). Após uma incubação de 16 horas a 4 ° C, os grânulos que se ligam ao anticorpo 3E7 podem ser selecionados usando um ímã de alta resistência. A informação do identificador dos grânulos selecionados é então analisada com um detector modelo DAS-4001EM ou DAS-4001 (Bio Medic Data Systems). A análise revelará que apenas ELAMS ™ em que YGGFL (SEQ ID NO: 1) foi sintetizado são selecionados pelo anticorpo 3E7.

Alternativamente, o ELAMS ™ pode ser incubado com anticorpo 3E7 que foi previamente conjugado com um fluoróforo, como fluoresceína ou rodamina, e a ligação peptídeo-anticorpo detectada com um fluorímetro ou microscópio de epifluorescência usando o comprimento de onda de luz apropriado

SÍNTESE PARALELA DE PEPTÍDEOS EM ELAMS ™

A. Derivatizando Amino ELAMS ™ com um Ligante

ELAMS ™ contendo grupos amino e cada um tendo uma etiqueta identificadora única são preparados como descrito no Exemplo II.A., acima. Os ELAMS ™ são tratados com uma mistura de éster N-hidroxisuccinimida de ácido 4-Fmoc-aminobutírico (1 mmol), HBTU (1 mmol), HOBt (1 mmol) e DIEA (1 mmol) em cloreto de metileno: DMF ( 10 mL). Após tratamento com vórtice por 30 minutos, a mistura de reação é diluída com DMF (10 mL), o ELAMS ™ sedimentado e o sobrenadante decantado. Os ELAMS ™ são lavados com DMF (3 × 10 mL). O procedimento de acoplamento pode ser repetido com reagentes frescos e o ELAMS ™ sedimentado e lavado como descrito acima.

B. Síntese Paralela de Peptídeos

O conjunto paralelo de oligômeros lineares é mostrado esquematicamente nas FIGS. 1 e 2. O método geral para montagem paralela de polipeptídeos pode ser ilustrado por meio de exemplo específico. Vinte ELAMS ™ derivatizados de ligante, cada um tendo uma etiqueta identificadora única (Exemplo III.A.), são colocados em um recipiente de reação e a sequência GGFL (SEQ ID NO: 5) sintetizada em cada um dos vinte ELAMS ™ usando síntese de peptídeo Fmoc padrão reagentes e química como descrito em Atherton & Sheppard, Solid Phase Peptide Synthesis: A Practical Approach, IRL Press, Oxford, England (1989).

Após a remoção dos grupos Fmoc por tratamento com 30% de piperidina em DMF por 60 min., Os ELAMS ™ são então distribuídos em vinte vasos de reação, um ELAM ™ por vaso. Cada vaso é então carregado com uma solução contendo um monômero de aminoácido (0,1 M), HBTU (0,1 M), HOBt (0,1 M) e DIEA (0,1 M) em 9: 1 cloreto de metileno: DMF por 30 min., Um diferente monômero de aminoácido por vaso. O acoplamento pode ser repetido com reagentes frescos por mais 30 min. Os ELAMS ™ são então lavados com DMF (3 ×) e depois com acetonitrila (3 ×). As informações da etiqueta identificadora são detectadas e registradas para cada ELAMS ™ em cada recipiente de reação, juntamente com a identidade do monômero adicionado. Os grupos de proteção da cadeia lateral são removidos usando a química de desprotecção padrão. Ver Atherton & Sheppard, Solid Phase Peptide Synthesis: A Practical Approach, IRL Press, Oxford, England (1989), e a biblioteca ensaiada como descrito no Exemplo II.F.

Para bibliotecas com maior diversidade, podem ser realizadas rodadas sucessivas de acoplamento e digitalização e gravação de tags identificadoras.

SÍNTESE PARALELA DE OCTAMERS OLIGONUCLEOTÍDEOS

A. Preparação de Hydroxyl ELAMS ™

Dezesseis ELAMS ™, ou múltiplos deles, cada um com uma etiqueta de identificação exclusiva, são limpos em NaOH concentrado, seguido por enxágue exaustivo em água. Os ELAMS ™ são derivatizados por 2 horas com uma solução de 10% (v / v) bis (2-hidroxietil) aminopropiltrietoxissilano (Petrarch Chemicals, Bristol, Pa.) Em etanol 95%, bem enxaguado com etanol (2 ×) e éter (2 ×), seco em vácuo a 40 ° C e aquecido a 100 ° C por 15 min.

Um ligante de síntese, 4,4-dimetoxitritil-hexaetiloxi-β-cianoetil fosforamidito, pode ser preparado usando 1,6-dihidroxihexano como material de partida de acordo com o método de Beaucage e Caruthers, Atkinson e Smith, "Solid Phase Synthesis of Oligodeoxyribnucleotides by the Phosphite-Triester Method, "in Gait, Oligonucleotide Synthesis: A Practical Approach, IRL Press, Oxford, England (1984) usando 2-cianoetil N, N-diisopropilclorofosforamidita (Sigma, St. Louis, Mo.) como o reagente de fosfitilação.

C. Anexo do Linker de Síntese

Os ligantes de síntese podem ser anexados a ELAMS ™ por meio da reação de ELAMS ™ hidroxilado (descrito no Exemplo IV.A., acima) com 4,4-dimetoxitritil-hexaetiloxi-β-cianoetil fosforamidita usando química de fosforamidita padrão, conforme descrito em Gait, Síntese de Oligonucleotídeo: A Practical Approach, IRL Press, Oxford, England (1984). As condições de reação típicas são fosforamidita 0,1 M, tetrazole 0,25 M em acetonitrila anidro por 1-3 min. Os ELAMS ™ são enxaguados com acetonitrila (3 ×).

Após o acoplamento, quaisquer grupos hidroxila que não reagiram podem ser tampados, se desejado. ELAMS ™ são adicionados à solução de cobertura fresca que é preparada da seguinte forma: 3 volumes de uma solução de 6,5% (p / v) 4-dimetilaminopiridina (DMAP) em tetrahidrofurano anidro (THF) são misturados com 1 volume de uma solução de 40% (v / v) anidrido acético em 2,6-lutidina. A reação é deixada prosseguir durante 1-3 min., Após o que os ELAMS ™ são enxaguados com cloreto de metileno (2 ×) e acetonitrilo (3 ×).

Após o capeamento, a ligação fosfito triéster é oxidada a um fosfotriéster tratando o ELAMS ™ com solução de iodo 0,1 M preparada pela dissolução de 2,6 g de iodo em uma mistura contendo 80 mL de THF, 20 mL de 2,6-lutidina e 2 mL de água por cerca de 1 min. Os ELAMS ™ são enxaguados com acetonitrila até o efluente ficar incolor.

Os grupos dimetoxitritilo que protegem os hidroxilos podem ser removidos por tratamento com ácido dicloroacético (DCA) a 2% (v / v) em cloreto de metileno durante cerca de 1 min. seguido de enxágue (3 ×) com cloreto de metileno. O número de grupos hidroxila por ELAMS ™ (isto é, a capacidade de carga) pode ser determinado tomando a absorvância do efluente de cátion dimetoxitritila a 498 nm (ε498 = 14.300M -1 cm -1).

D. Preparação da Sonda Fluoresceinilada

Uma sonda alvo de sequência 5'-GCGCGGGC-fluoresceína pode ser preparada usando vidro de poro de controle 3'-Amine-ON ™ (CPG) (Clontech, Palo Alto, Calif.) E reagentes de síntese de DNA padrão (Applied Biosystems, Foster City, Calif. .). A 3'-amina pode ser marcada com isotiocianato de fluoresceína para gerar um oligômero marcado com 3'-fluoresceína de acordo com as instruções do fabricante fornecidas com 3'-Amine-ON ™ CPG.

E. Síntese Paralela de Octanucleotídeos

Sequências de oligômero alvo, representadas pela matriz 3'-CGC (A + T + C + G) 2 CCG pode ser preparada sintetizando em cada um dos dezesseis ELAMS ™ derivatizados de ligante, cada um tendo uma etiqueta identificadora única (descrita no Exemplo IIV. C.) sequência polinucleotídica 3'-CGC usando reagentes de síntese de DNA lábil em bases padrão e química (Applied Biosystems, Foster City, Califórnia). Após o ciclo de acoplamento, os ELAMS ™ são distribuídos em quatro vasos de reação, quatro ELAMS ™ por vaso. Um monômero de nucleotídeo único (como o fosforamidito protegido) é acoplado ao ELAMS ™ em cada vaso de reação usando reagentes de síntese de DNA lábil em base padrão e química, um monômero de nucleotídeo diferente por vaso e as etapas de capeamento, oxidação e remoção de DMT concluídas.

A etiqueta identificadora de cada ELAMS ™ em cada recipiente de reação é detectada e registrada usando, por exemplo, um scanner modelo DAS-4001EM ou modelo DAS-4001 (Bio Medic Data Systems, Maywood, NJ), juntamente com a identidade de cada monômero adicionado em cada navio. Os ELAMS ™ são então distribuídos colocando um ELAMS ™ de cada vaso de reação atual em cada um dos quatro novos vasos de reação e um segundo monômero de nucleotídeo adicionado conforme descrito acima, um monômero diferente por vaso. As informações do identificador são detectadas e registradas para cada ELAMS ™ em cada recipiente de reação, juntamente com a identificação do monômero adicionado em cada recipiente.

Os ELAMS ™ são então agrupados em um único recipiente de reação e a sequência 3-CCG adicionada a cada ELAMS ™ usando reagentes e química de síntese de DNA padrão. Os grupos de proteção de amina exocíclica são removidos por tratamento com HCl conc. amônia de acordo com as instruções do fabricante para fosforamiditos de nucleotídeos lábeis em bases.

HIBRIDIZAÇÃO DE ALVO ESPECÍFICO DE SEQUÊNCIA

Os ELAMS ™ desprotegidos são incubados com a sonda fluoresceinilada sob condições conducentes à hibridização específica da sequência, conforme descrito em Hames e Higgins, Nucleic Acid Hybridization: A Practical Approach, IRL Press, Oxford, England (1985). Após os ciclos de enxágue, o ELAMS ™ pode ser interrogado quanto à hibridização usando um fluorímetro ou microscópio de epifluorescência (excitação com íon argônio 488 nm). Os ELAMS ™ exibindo as contagens de fótons mais altas são isolados e a etiqueta identificadora digitalizada e comparada ao histograma de reação para aquela etiqueta identificadora específica, revelando que a sequência 3'-CGCGCCCG foi sintetizada no ELAM ™ exibindo a contagem de fótons mais alta.

Embora a invenção deste pedido de patente seja divulgada por referência a exemplos específicos, entende-se que a presente invenção pode ser aplicada a todos os produtos químicos que são passíveis de estratégias combinatórias e a todas as etiquetas identificadoras que relacionam informações a um detector quando pulsado com radiação eletromagnética . Além disso, a presente invenção se destina a ser aplicável a todas as futuras sínteses de matriz combinatória de fase sólida e multicomponentes desenvolvidas e a todas as futuras etiquetas de identificação que relacionam informações a um detector quando pulsado com informações eletromagnéticas.


MATERIAIS E MÉTODOS

Suporte sólido monoalquino e bromofosforodiamiditas para oligômeros click

A preparação do suporte sólido monoalquino e bromofosforodiamiditas foi realizada de acordo com Lietard et al. (37). A única diferença foi que mais uma etapa foi adicionada para obter o suporte modificado no qual um grupo succínico foi incorporado em 1-Propargyl-2 - [(4,4΄-dimetoxitritil) oximetil] -2-metilpro-pane-1,3 -diol e, em seguida, o suporte LCAA-CPG foi acoplado.

Síntese e purificação de DNA / RNA

Os oligonucleotídeos foram sintetizados quimicamente em um sintetizador de DNA / RNA da Applied Biosystems, usando a química de fosforamidito de cianoetil ou adquiridos na Future Synthesis. Todos os nucleótidos e fosforamiditos de hexaetilenoglicol com 2'-O-tertbutildimetilsililo foram adquiridos a Glen Research, Azco, Proligo. O linker estilbeno diether foi sintetizado usando um serviço de síntese personalizado. Antes da etapa de desproteção, os oligômeros de clique foram tratados com LiN3 (300 eq) em dimetilformamida (DMF) durante 2 h a 65 ° C. Os oligômeros de RNA foram clivados do suporte sólido usando hidróxido de amônio / etanol (3: 1 v / v) a 55 ° C por 16 h. A desprotecção foi realizada com tri-hidrofluoreto de trietilamina a 55 ° C durante 3 h seguido pelo n- precipitação com butanol durante 1 h a 4 ° C. Os oligômeros foram dessalinizados em colunas illustra NAP-25 (GE Healthcare) e purificados por eletroforese em gel em condições desnaturantes. No caso do oligômero de DNA este foi clivado e desprotegido por hidróxido de amônio a 55 ° C por 16 h, dessalinizado e purificado por eletroforese em gel desnaturante.

Expressão e purificação de T4 RNA ligase 1

O plasmídeo contendo o gene T4 RNA ligase foi um presente generoso do Prof. Peter J. Unrau da Simon Fraser University no Canadá (38). A estrutura de leitura aberta da ligase de RNA de T4 foi clonada novamente no vetor pMCSG9 (Midwest Center for Structural Genomics) contendo uma etiqueta His6 N-terminal. A construção com o gene pMCSG9 T4 RNA ligase foi obtida por clonagem independente de ligase (39). A identidade do clone foi confirmada por sequenciação. A enzima foi produzida em Escherichia coli Células mágicas BL21 em meio Luria-Bertani (Midwest Center for Structural Genomics). A expressão foi induzida com 1 mM de isopropil β-D-1-tiogalactopiranosídeo (IPTG) e realizada por 16 h a 19 ° C. As células foram colhidas por centrifugação (4000 g, 15 min, 4 ° C) e ressuspenso no tampão de lise (Tris-HCl 50 mM pH 8,0, NaCl 0,5 M, imidazol 20 mM, Na 10 mM4P2O7, Glicerol a 5%, tris (2-carboxietil) fosfina (TCEP) 1 mM e um coquetel de inibidores de protease). As células foram lisadas por sonicação: pulso de 2 s seguido por pausa de 10 s (25 min a 4 ° C). Detritos celulares foram removidos por centrifugação (15.000 g, 30 min, 4 ° C). O sobrenadante foi misturado com 6 ml de Ni Sepharose High Performance (GE Healthcare) equilibrado com 50 mM Tris-HCl pH 8,0, 0,5 M NaCl, 10 mM Na4P2O7 e 5% de glicerol. As contas de sefarose foram lavadas com 50 ml de tampão I (Tris-HCl 50 mM pH 8,0, NaCl 0,5 M, imidazol 40 mM, Na 10 mM4P2O7, Glicerol a 5%, TCEP 1 mM) e 200 ml de tampão II (Tris-HCl 50 mM pH 8,0, NaCl 0,5 M, imidazol 40 mM, glicerol 5%, TCEP 1 mM). A proteína foi eluída com 2 × 10 ml de tampão III (Tris-HCl 50 mM pH 8,0, NaCl 0,5 M, imidazol 300 mM, glicerol 5%, TCEP 1 mM) e dialisada em Tris-HCl 50 mM pH 8,0, 0,5 M NaCl, 20% de glicerol e 1 mM de TCEP e em seguida no tampão de armazenamento (20 mM HEPES-KOH pH 7,5, 50 mM de KCl, 1 mM de ditiotreitol (DTT) e 50% de glicerol). A pureza da proteína recombinante foi avaliada por eletroforese em gel de dodecilsulfato de sódio-poliacrilamida (SDS-PAGE).

Circularização de oligômeros de RNA usando T4 RNA ligase 1

Os oligômeros de RNA (20-50 μM) foram desnaturados em 95 ° C por 2 min em KCl 50 mM e resfriados lentamente a 25 ou 37 ° C. A reação de ligação foi realizada usando 0,25-0,40 mg / ml de T4 RNA ligase 1 em tampão (Tris 50 mM pH 7,5, MgCl2 10 mM e DTT 10 mM) com ATP 0,5 mM a 37 ° C por 4 h. A solução foi dessalinizada usando colunas de poliacrilamida P-6 Bio-Gel (Biorad) e resolvida em eletroforese em gel desnaturante de 6–10%. Os géis foram corados com azul de toluidina ou SYBR Green II. Para as medições de fusão no UV, oligômeros circularizados foram eluídos pelo método crash-and-soak, dessalinizados e concentrados usando filtros centrífugos.

Desfosforilação de RNA e marcação com 32 P

A reação de desfosforilação de RNA linear ou circular foi realizada usando fosfatase alcalina (Thermo) a 37 ° C por 10 min em um tampão contendo Tris-HCl 100 mM pH 8,0, MgCl 50 mM2, 1 M KCl, 0,2% Triton X-100 e 1 mg / ml Albumina de soro bovino. A enzima foi desativada por aquecimento a 75 ° C por 10 min. O RNA foi precipitado com etanol ou carregado diretamente no gel.

Os oligômeros de RNA foram marcados na extremidade 5 'com [γ- 32 P] ATP (Hartmann-Analytic) usando T4 polinucleotídeo quinase (Thermo). Antes da reação, o RNA foi desnaturado por 5 min a 90 ° C e incubado em gelo por 10 min. A reação foi realizada em um tampão contendo 50 mM Tris-HCl pH 7,6, 10 mM MgCl2, DTT 5 mM, espermidina 0,1 mM suplementada com 1 μl de [γ- 32 P] ATP (0,02 mCi) e 10 U de enzima. A reação foi incubada durante 30 min a 37 ° C. Os RNAs marcados foram purificados por eletroforese em gel desnaturante e quantificados usando um contador de cintilação.

Hidrólise alcalina de RNA

Um volume de 5΄ 32 P-marcado RNA foi misturado com cinco volumes de 10 mM MgCl2 em formamida e incubado a 100 ° C por 10 min. A reação foi interrompida pela adição de um volume de tampão de carga (formamida, 0,02% de xileno cianol) e congelada em gelo seco. Os produtos da reação foram separados em géis desnaturantes e visualizados usando autorradiografia com uma tela intensificadora em Fluor Imager FLA-5100 (FujiFilm).

Fusão de oligonucleotídeos por UV

Os estudos de fusão térmica UV foram realizados de acordo com Pasternak e Wengel (2011) (40) no espectrômetro DU-640 com um termoprogramador (Beckman). Os oligômeros de RNA foram dissolvidos em um tampão contendo cloreto de sódio 10 mM, cacodilato de sódio 20 mM e etilenodiaminotetracetato dissódico 0,5 mM (EDTA), pH 7,0 ou 5,2. Cada oligômero foi preparado em nove concentrações diferentes na faixa de 10 −5 –10 −6 M. As concentrações de oligômeros de fita simples foram calculadas a partir da absorbância de alta temperatura (& gt80 ° C) e coeficientes de extinção de fita simples aproximados pelo modelo vizinho mais próximo . A absorção de UV versus temperatura foi medida a 260 nm na taxa de aquecimento de 1 ° C / min no intervalo de 20–90 ° C. As curvas de fusão foram analisadas e os parâmetros termodinâmicos calculados usando MeltWin 3.5.

Reação ao clique

Antes da reação, 1 nmol de DNA ou oligômero de RNA foi desnaturado em água por 2 min a 95 ° C e colocado em gelo por 10 min. A reação foi realizada em NaCl 200 mM, complexo de cobre (II) -tris (benziltriazolilmetil) amina (Cu (II) -TBTA) 500μM e ácido ascórbico 5 mM recém-preparado. A reação de clique foi incubada a 37 ° C por 4 h. A reação foi dessalinizada usando colunas de poliacrilamida P-6 de Bio-Gel e analisada em géis de poliacrilamida desnaturante de 10-15%.

Digestão de HpaII

O oligômero de DNA linear ou circular (10 μg) foi digerido em um tampão contendo 1 × tampão Tango e 40U de enzima HpaII a 37 ° C durante a noite. A enzima foi desativada por aquecimento a 65 ° C por 20 min. A mistura de reação foi dessalinizada usando colunas de poliacrilamida P-6 de Bio-Gel ou precipitada usando cloreto de lítio e cinco volumes de mistura de EtOH / acetona (1: 1 v / v). Os produtos da reação foram separados em gel de poliacrilamida desnaturante a 20% e visualizados por sombra UV.


Métodos

Construções genéticas e mutagênese

pRSF-oRibo-Q1-oGST-CaM1TAG 19, contendo um ribossomo ortogonal sob um promotor indutível por IPTG e a proteína de interesse sob um promotor constitutivamente ativo, e pKW1 21, contendo os aaRS e tRNA ortogonais, para supressão de âmbar foram um presente gentil do Laboratório Chin (MRC LMB, Cambridge , Reino Unido). O modelo PR65 estava disponível como um GST-PR65-H clivável por trombina6 proteína de fusão em uma estrutura pRSETa. Todos os primers estão listados na Tabela S2 (informações complementares). O comprimento e a sequência corretos de todas as construções foram verificados por sequenciamento de Sanger e digestão de restrição.

Para a supressão de âmbar, os construtos foram criados introduzindo primeiro o códon TAG nas posições de D5 / L588 e E277 na proteína de fusão GST-PR65-H6 usando mutagênese dirigida ao local Round-the-Horn (RTH-SDM) 24. Diferentes locais de fixação ponta a ponta foram testados inicialmente, mas D5 / L588 foi o primeiro clone a funcionar e, portanto, foi levado adiante.100 μM primers foram fosforilados usando polinucleotídeo quinase (ThermoFischer) e 2-3 mM ATP de acordo com o protocolo do fabricante. A enzima foi inativada por calor a 85 ° C por 10-15 min e os primers fosforilados foram armazenados a -20 ° C até o uso. Os PCRs foram realizados usando esses primers e Phusion High-Fidelity DNA polimerase (NEB). Os produtos de PCR foram purificados em gel e 50–100 μg de material de DNA foram adicionados a 1 μl Anza ™ T4 DNA Ligase Master Mix (ThermoFischer) em um volume total de 4 μl, incubado por 10–20 min em temperatura ambiente e transformado em - produzido em casa, DH5α quimicamente competente E. coli células.

Os construtos resultantes foram então transferidos para pRSF-oRibo-Q1-oGST usando o GST- SwaI interno e pós-H6 Sítios de restrição SpeI e Clonagem In-Fusion (Takara Bio). pRSF-oRibo-Q1-oGST foi digerido usando SwaI e SpeI, enquanto o inserto PR65 foi obtido por PCR com iniciadores que tinham 15 pb sobrepostos a esses locais de restrição e ao esqueleto do vetor. O vetor e a inserção foram purificados em gel e 1 μl de cada um foi misturado com 0,5 μl 5X In-Fusion HD Enzyme Premix em gelo. A reação foi incubada por 15 min a 50 ° C em um termociclador pré-aquecido e colocada de volta no gelo imediatamente após. 2–4 μl da reação de ligação foram transformados em DH5α de alta eficiência E. coli (NEB).

As marcas ybbR dos terminais N e C (DSLEFIASKLA) foram introduzidas entre o local de clivagem da trombina e M1, e A589 e o códon de parada usando RTH-SDM com iniciadores carregando a sequência da marca na saliência 5 '.

Expressão e purificação de proteínas

PR65 WT e a versão marcada com ybbR (yPR65y) foram transformados em C41 quimicamente competente E. coli (Laboratório Kommander, MRC-LMB, Cambridge). As culturas em suspensão foram cultivadas a 37 ° C em meio 2xYT contendo 50 μg / ml de Ampicilina, agitando a 200 rpm até uma DO600 de 0,6 a 0,8. A expressão da proteína foi induzida com 250 μM de isopropil β-D-1-tiogalactopiranosídeo (IPTG, Generon) a 25 ° C durante a noite. As células foram colhidas por centrifugação a 4000 × g por 10 min a 4 ° C, antes de ressuspender em tampão de lise (Tris-HCl 50 mM pH 7,5, NaCl 500 mM, DTT 2 mM) suplementado com coquetel de inibidor de protease livre de EDTA ( Sigma Aldrich) e DNase I (Sigma Aldrich). As células foram lisadas passando a suspensão através de um Emulsiflex-C5 (AVESTIN) a pressões entre 10000 e 15000 psi. A proteína solúvel foi separada dos resíduos celulares e outras frações insolúveis por centrifugação a 35000 × g durante 35 min a 4 ° C. A fração de proteína solúvel foi aplicada a resina de glutationa (Amintra Affinity Resins, Expedeon) equilibrada em tampão de lise. A resina foi incubada a 4 ° C por 1-2 horas com rotação e limpa usando tampão de lavagem (50 mM Tris-HCl pH 7,5, 150 mM NaCl, 2 mM DTT), seguido por clivagem na matriz da proteína usando 50 unidades de trombina bovina (Sigma) por litro de cultura a 4 ° C durante a noite. A proteína clivada foi removida da resina usando tampão de lavagem. Todas as frações contendo proteína foram reunidas, diluídas de modo que a concentração de NaCl fosse & lt50 mM e aplicadas a um Mono Q 10/100 GL (GE Healthcare) equilibrado em Tris-HCl 100 mM pH 8,0, EDTA 2 mM, 0,5 g / l EGTA, DTT 2 mM. Depois de lavar a coluna, a proteína foi subsequentemente eluída usando um gradiente de sal de 20 volumes de coluna de 0 a 1 M de NaCl. Se necessário, as frações MonoQ contendo a proteína foram concentradas antes da aplicação a um HiLoad 26/600 Superdex 200 pg (GE Healthcare) equilibrado em PBS pH 7,4, DTT 2 mM. As frações contendo proteína pura foram reunidas e concentradas usando um concentrador centrífugo Vivaspin®

A expressão e purificação de construtos de supressão âmbar foram adaptados a partir de um protocolo descrito por Sachdeva et al. 20 Proteínas de fusão GST de PR655 / 588TAG e yPR65277TAG foram expressos em eletrocompetente MDS42 ΔrecA E. coli células, cultivadas a 37 ° C em 2xYT contendo 25 μg / ml de canamicina e 37,5 μg / ml de Espectinomicina. A expressão foi induzida a 37 ° C por 5 horas quando OD600 = 0,5–0,6, usando 1 mM IPTG e 2 mM de qualquer N-ε- (Prop-2-iniloxicarbonil) -L-lisina (Iris Biotech GmbH), N-ε- ((2-Azidoetoxi) carbonil) -L-lisina (Iris Biotech GmbH) ou N-ε- [[(2-metil-2-ciclopropeno-1-il) metoxi] carbonil] -L-lisina (Sirius Fine Chemicals), que foram dissolvidos em NaOH 0,2 M, diluídos 1: 3 usando HEPES 1 M pH 7,4 e ajustados ao pH da cultura de células. Proteínas contendo azidas e derivados de ciclopropeno foram purificadas em tampões sem agente redutor. Todas as proteínas foram primeiro purificadas por redução da glutationa e clivagem da trombina a 4 ° C como descrito acima. O produto de clivagem foi aplicado a 1 ml de resina Ni-NTA por litro de cultura (Amintra Affinity Resins, Expedeon) ou uma coluna HisTrap Excel de 1 ml (GE Healthcare) equilibrada em tampão de lavagem (50 mM Tris-HCl pH 7,5, 150 mM NaCl, opcionalmente com DTT 2 mM). A resina foi incubada a 4 ° C por 1–2 horas com rotação e limpa com tampão de lavagem, enquanto a proteína ligada à coluna foi lavada com 20 volumes de coluna de tampão de lavagem. A proteína ligada foi recuperada usando tampão de eluição (Tris-HCl 100 mM pH 8,0, EDTA 2 mM, imidazol 300 mM, DTT 2 mM). Após a análise das frações de eluição obtidas a partir de qualquer método por SDS-PAGE, as eluições foram concentradas e o tampão trocado por PBS pH 7,4 com 1 mM de DTT (alcino) ou sem DTT (azida, ciclopropeno) usando colunas de dessalinização Zeba Spin (ThermoFisher Scientific) .

Para a expressão da Sfp-sintase, consulte as Informações Suplementares. Todas as proteínas foram congeladas rapidamente em N líquido2 e armazenado a -80 ° C.

Oligômeros de DNA quimicamente modificados

Os oligos de DNA para conjugações de DNA-proteína (Tabela S2) com modificações de extremidade 3 'com coenzima A ou azida foram adquiridos da Biomers e Integrated DNA Technologies, respectivamente. Os oligos modificados foram ressuspensos em MilliQ H2O, aliquotado e armazenado a −20 ° C (azida, amina) ou −80 ° C (CoA).

O protocolo para modificação química de oligos com funcionalidades DBCO e tetrazina foi adaptado de Nojima et al. 9 DBCO-PEG4-NHS-éster (Sigma) e 6-metil-tetrazina-PEG5-NHS-éster (Jena Bioscience) foram conjugados a oligos de DNA modificados com 3′-amina (Integrated DNA Technologies) em 50 μl de Bicina-KOH pH 8,0 contendo 100 μM de amina e 5 mM de NHS-éster. Devido à sua hidrofobicidade, as reações contendo DBCO foram realizadas em DMSO a 25% (Sigma) para garantir a solubilidade total do composto. A reação foi incubada a 37 ° C por 2-3 horas em um agitador orbital e carregada em uma coluna de troca aniônica (1 ml DEAE FF, GE Healthcare) equilibrada em 50 mM Tris-HCl pH 7,4. O oligo ligado foi eluído em uma etapa usando Tris-HCl 50 mM, pH 7,4, NaCl 1 M. As frações contendo oligo foram isoladas, divididas em alíquotas de 500 μl, combinadas com 1 ml gelado, etanol absoluto e incubadas a −80 ° C por pelo menos 1 hora. O precipitado foi sedimentado durante 30 min por centrifugação a 0 ° C e 20.000 × g. O sobrenadante foi cuidadosamente aspirado e descartado. Os sedimentos foram lavados com 1 ml de temperatura ambiente, etanol a 95% (v / v) e recolhidos por centrifugação renovada durante 10 min a 4 ° C e 20.000 × g. O sobrenadante foi descartado, os pellets foram secos ao ar e, em seguida, ressuspensos em MilliQ H2O deve ser armazenado a −20 ° C.

Conjugando DNA e proteína

Para fins de otimização, o CuAAC foi realizado em volumes de 20 μl de PBS com 5 μM de proteína portadora de alcino que foram reagidos a 100 μM de azida usando uma gama de concentrações de catalisador. Sulfato de cobre (CuSO4), ascorbato de sódio (NaAsc) e THPTA foram pré-misturados em uma "mistura de clique" (CM). O 100X CM conforme definido por Sachdeva et al. 20 contém CuSO 10 mM4, NaAsc 25 mM, THPTA 50 mM e foi usado em uma concentração final de 1X. Uma mistura click 100X com dez vezes a quantidade de NaAsc (CM-A) contém CuSO 10 mM4, NaAsc 250 mM e THPTA 25 50 mM. As amostras foram incubadas a 25 ° C por 0,5–2 horas ou durante a noite. Para interromper a reação, a amostra foi trocada por tampão ou misturada diretamente com o tampão de amostra SDS-PAGE. Para experimentos de prova de conceito e otimização, PR65 com alcino (alkPR65alk) reagiu com 5-FAM-azida (Lumiprobe). Para produzir quimeras de proteína-DNA, oligômeros de DNA funcionalizados com azida (Integrated DNA Technologies) reagiram com alkPR65alk. Para testar a funcionalidade da azida-oligo adquirida, 20 μM de oligo foram marcados com 20 μM de corante alcino 5-FAM (Lumiprobe) e quantidades crescentes de CM-A, amostrando CuSO final4 concentração de 20 μM a 1 mM. Essas condições otimizadas foram então usadas para reagir 20 μM de proteína com 100 μM de oligo de azida em um volume de 20 μl usando 10X CM-A.

As reações de ensaio SPAAC e IED-DA foram realizadas em volumes de 10 e 20 μl de PBS contendo proteínas 5 μM e oligo modificado de 10–20 μM, respectivamente. As reações de controle para proteínas contendo azida foram realizadas usando TAMRA-DBCO (Jena Bioscience). As misturas de reação foram incubadas por durações variáveis ​​(0,5 horas a durante a noite) à temperatura ambiente em um agitador orbital.

Para a conjugação de proteína-DNA mediada por Sfp-sintase, as condições de reação conforme descrito por Yin et al. 7 (100 μl de HEPES 50 mM pH 7,5, MgCl 10 mM2, 5 μM de proteína marcada com ybbR, 5 μM de biotina-CoA e 0,1 μM de Sfp-enzima) não produziram conjugação de DNA-proteína detectável. Várias condições foram rastreadas e descobriu-se que a concentração de Sfp era o fator limitante. Ao incluir a enzima em pelo menos uma quantidade estequiométrica igual à do marcador ybbR, as reações produziram o produto desejado. Ao combinar acessórios mediados por SPAAC e Sfp, 5 μM de construtos PR65 contendo uma etiqueta ybbR e uma funcionalidade de azida reagiram a 10 μM de cada CoA-oligo e DBCO-oligo em 10 μl de HEPES 50 mM pH 7,5, MgCl 10 mM2. As reações de controle foram realizadas omitindo um oligo de cada vez.

Os produtos da reação dos acoplamentos oligo-corante foram analisados ​​por eletroforese usando géis de agarose não corados a 1%. As reações proteína-corante e proteína-oligo foram analisadas por SDS-PAGE. Antes dos géis de poliacrilamida serem corados com Coomassie Blue, as bandas fluorescentes foram fotografadas sob UV usando um transiluminador (UVP, LLC).

As reações bem-sucedidas foram dimensionadas para até 50 μl, contendo 10 μM e um excesso de 1 ou 2 vezes (dependendo da disponibilidade) do oligo modificado em relação ao número de marcadores ybbR e / ou UAAs. Após incubação durante a noite, essas reações foram purificadas por cromatografia de exclusão de tamanho usando um Superdex 200 10/300 GL (GE Healthcare) ou um YMC-Pack Diol-300 (Yamamura Chemical Research). As frações foram analisadas por SDS-PAGE e aquelas contendo a maioria da proteína conjugada a dois oligos de DNA foram hibridizadas para alças de DNA e analisadas por eletroforese em gel de agarose.

Desnaturação de equilíbrio

PR65 marcado com WT e ybbR foi trocado por tampão em MES 50 mM, pH 6,5, DTT 1 mM. Amostras de um volume total de 150 μl foram preparadas em placas pretas de 96 poços (Corning, baixa ligação) com gradientes de uréia de 0 M a 8 M. As concentrações finais de proteína foram de aproximadamente 1 μM. As amostras foram incubadas em um agitador orbital a 25 ° C por 2 h. Os triptofanos foram excitados a 295 ± nm e a fluorescência foi monitorada a 340 ± 10 nm usando um leitor de microplacas CLARIOStar (BMG Labtech). Os dados de 4 leituras foram calculados, então normalizados e ajustados a uma equação de três estados:

Onde FN e Fvocê são a fluorescência dos estados dobrado e desnaturado, respectivamente, e podem ser descritos por


Assista o vídeo: Determine RNA sequence from coding DNA (Agosto 2022).